Incidental Mutation 'R4050:Olfr1181'
ID314090
Institutional Source Beutler Lab
Gene Symbol Olfr1181
Ensembl Gene ENSMUSG00000075125
Gene Nameolfactory receptor 1181
SynonymsMOR225-9P, GA_x6K02T2Q125-49911636-49910701
MMRRC Submission 040968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4050 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88420321-88426171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88423623 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 134 (M134T)
Ref Sequence ENSEMBL: ENSMUSP00000150939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099823] [ENSMUST00000102619] [ENSMUST00000213190] [ENSMUST00000216121] [ENSMUST00000217320]
Predicted Effect probably damaging
Transcript: ENSMUST00000099823
AA Change: M134T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097411
Gene: ENSMUSG00000075125
AA Change: M134T

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 1.5e-48 PFAM
Pfam:7tm_1 39 285 6.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102619
AA Change: M134T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099679
Gene: ENSMUSG00000075125
AA Change: M134T

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 285 7.2e-26 PFAM
Pfam:7tm_4 137 278 3.5e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213190
AA Change: M134T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000216121
Predicted Effect probably benign
Transcript: ENSMUST00000217320
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,944,992 D473G probably damaging Het
9530053A07Rik T C 7: 28,152,985 V1311A possibly damaging Het
Abca1 T A 4: 53,044,144 Q1826L probably damaging Het
Apob G A 12: 8,015,390 V4087I probably benign Het
Atp10b G A 11: 43,259,536 A1354T probably benign Het
Baz1a A G 12: 54,929,619 V424A probably benign Het
Cdc20b G A 13: 113,064,285 D180N probably benign Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Ddb1 A G 19: 10,627,807 D1053G probably benign Het
Ddx39 T A 8: 83,722,234 M246K probably benign Het
Dip2a G A 10: 76,278,607 T1013M probably damaging Het
Edar G T 10: 58,609,947 T265N possibly damaging Het
Fam207a T C 10: 77,514,330 R75G possibly damaging Het
Fam208b A G 13: 3,573,507 S2148P probably benign Het
Gbp8 T A 5: 105,031,238 I132F probably damaging Het
Gga1 A G 15: 78,891,491 D382G probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm10518 C A 1: 179,803,813 probably benign Het
Gm13078 T C 4: 143,727,122 S267P probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
H2-Eb1 T A 17: 34,314,368 L188Q probably damaging Het
Heatr6 A G 11: 83,755,773 S95G probably damaging Het
Hnf1a T A 5: 114,970,574 N91Y probably damaging Het
Ints10 C T 8: 68,827,351 S710F probably damaging Het
Kazn C T 4: 142,106,904 E614K unknown Het
Kif26a T A 12: 112,179,916 M1812K probably benign Het
Lmo7 A T 14: 101,902,277 K488* probably null Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Met A G 6: 17,533,984 T645A probably benign Het
Mpp4 T C 1: 59,146,744 probably null Het
Mycl A T 4: 122,996,839 probably null Het
Ncbp1 G A 4: 46,147,483 R110H probably damaging Het
Nfasc G T 1: 132,610,305 probably benign Het
Nup35 A G 2: 80,655,976 I212V probably benign Het
Olfr1373 T G 11: 52,145,134 Y132S probably damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcgf5 G A 19: 36,442,911 S181N probably damaging Het
Plk2 C T 13: 110,399,866 T617I probably damaging Het
Polq A T 16: 37,092,820 probably null Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Prune1 T C 3: 95,262,231 K220R possibly damaging Het
Rab3gap2 G A 1: 185,272,643 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall3 G A 18: 80,971,482 A1005V probably benign Het
Samd15 T G 12: 87,200,632 N30K probably benign Het
Scn8a A T 15: 101,013,413 K905* probably null Het
Scrib G A 15: 76,051,473 R1245W possibly damaging Het
Skint4 C T 4: 112,124,614 S260L probably benign Het
Slc29a2 A T 19: 5,029,453 M339L possibly damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Synpo2 T C 3: 123,114,278 D463G possibly damaging Het
Taf4 C A 2: 179,932,012 G688C probably damaging Het
Tpte T A 8: 22,365,984 V600E probably damaging Het
Ttn A G 2: 76,821,166 V10953A probably benign Het
Vav2 T C 2: 27,288,679 Y333C probably benign Het
Vav2 A G 2: 27,291,403 S311P probably damaging Het
Zbtb26 A C 2: 37,436,988 M1R probably null Het
Zfp26 G A 9: 20,442,229 P88L probably benign Het
Zfp324 T C 7: 12,970,867 F328L probably damaging Het
Other mutations in Olfr1181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Olfr1181 APN 2 88423786 missense probably benign 0.30
IGL02224:Olfr1181 APN 2 88423708 splice site probably null
IGL03293:Olfr1181 APN 2 88423227 missense probably damaging 1.00
IGL02802:Olfr1181 UTSW 2 88423488 missense probably benign 0.23
R2214:Olfr1181 UTSW 2 88423117 missense probably benign 0.00
R2508:Olfr1181 UTSW 2 88423456 missense possibly damaging 0.95
R5404:Olfr1181 UTSW 2 88423801 missense probably damaging 0.98
R5727:Olfr1181 UTSW 2 88423447 missense probably benign 0.00
R6578:Olfr1181 UTSW 2 88423144 missense probably benign 0.12
R6663:Olfr1181 UTSW 2 88423350 missense probably benign 0.25
R6974:Olfr1181 UTSW 2 88423812 missense possibly damaging 0.93
R7042:Olfr1181 UTSW 2 88423402 missense possibly damaging 0.89
R7659:Olfr1181 UTSW 2 88423926 missense probably damaging 1.00
R8443:Olfr1181 UTSW 2 88423401 missense probably benign
X0018:Olfr1181 UTSW 2 88423662 missense probably benign
Z1177:Olfr1181 UTSW 2 88423815 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAAGGCAACCATTCCCGAATTG -3'
(R):5'- CTGTGTGACACCCAAATTGATTG -3'

Sequencing Primer
(F):5'- CACCAATGATGTAGGTATCAGTGC -3'
(R):5'- GGGGATCTGCTTGCCGAAAG -3'
Posted On2015-04-30