Incidental Mutation 'R4050:Skint4'
ID314097
Institutional Source Beutler Lab
Gene Symbol Skint4
Ensembl Gene ENSMUSG00000055960
Gene Nameselection and upkeep of intraepithelial T cells 4
Synonyms
MMRRC Submission 040968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4050 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112072016-112168076 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112124614 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 260 (S260L)
Ref Sequence ENSEMBL: ENSMUSP00000102176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069769] [ENSMUST00000106564] [ENSMUST00000106565] [ENSMUST00000106566]
Predicted Effect probably benign
Transcript: ENSMUST00000069769
AA Change: S252L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000070676
Gene: ENSMUSG00000055960
AA Change: S252L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106564
AA Change: S252L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102174
Gene: ENSMUSG00000055960
AA Change: S252L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106565
AA Change: S252L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102175
Gene: ENSMUSG00000055960
AA Change: S252L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106566
AA Change: S260L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102176
Gene: ENSMUSG00000055960
AA Change: S260L

DomainStartEndE-ValueType
IG 41 148 7.24e-10 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 304 326 N/A INTRINSIC
transmembrane domain 350 372 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119233
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,944,992 D473G probably damaging Het
9530053A07Rik T C 7: 28,152,985 V1311A possibly damaging Het
Abca1 T A 4: 53,044,144 Q1826L probably damaging Het
Apob G A 12: 8,015,390 V4087I probably benign Het
Atp10b G A 11: 43,259,536 A1354T probably benign Het
Baz1a A G 12: 54,929,619 V424A probably benign Het
Cdc20b G A 13: 113,064,285 D180N probably benign Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Ddb1 A G 19: 10,627,807 D1053G probably benign Het
Ddx39 T A 8: 83,722,234 M246K probably benign Het
Dip2a G A 10: 76,278,607 T1013M probably damaging Het
Edar G T 10: 58,609,947 T265N possibly damaging Het
Fam207a T C 10: 77,514,330 R75G possibly damaging Het
Fam208b A G 13: 3,573,507 S2148P probably benign Het
Gbp8 T A 5: 105,031,238 I132F probably damaging Het
Gga1 A G 15: 78,891,491 D382G probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm10518 C A 1: 179,803,813 probably benign Het
Gm13078 T C 4: 143,727,122 S267P probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
H2-Eb1 T A 17: 34,314,368 L188Q probably damaging Het
Heatr6 A G 11: 83,755,773 S95G probably damaging Het
Hnf1a T A 5: 114,970,574 N91Y probably damaging Het
Ints10 C T 8: 68,827,351 S710F probably damaging Het
Kazn C T 4: 142,106,904 E614K unknown Het
Kif26a T A 12: 112,179,916 M1812K probably benign Het
Lmo7 A T 14: 101,902,277 K488* probably null Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Met A G 6: 17,533,984 T645A probably benign Het
Mpp4 T C 1: 59,146,744 probably null Het
Mycl A T 4: 122,996,839 probably null Het
Ncbp1 G A 4: 46,147,483 R110H probably damaging Het
Nfasc G T 1: 132,610,305 probably benign Het
Nup35 A G 2: 80,655,976 I212V probably benign Het
Olfr1181 A G 2: 88,423,623 M134T probably damaging Het
Olfr1373 T G 11: 52,145,134 Y132S probably damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcgf5 G A 19: 36,442,911 S181N probably damaging Het
Plk2 C T 13: 110,399,866 T617I probably damaging Het
Polq A T 16: 37,092,820 probably null Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Prune1 T C 3: 95,262,231 K220R possibly damaging Het
Rab3gap2 G A 1: 185,272,643 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall3 G A 18: 80,971,482 A1005V probably benign Het
Samd15 T G 12: 87,200,632 N30K probably benign Het
Scn8a A T 15: 101,013,413 K905* probably null Het
Scrib G A 15: 76,051,473 R1245W possibly damaging Het
Slc29a2 A T 19: 5,029,453 M339L possibly damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Synpo2 T C 3: 123,114,278 D463G possibly damaging Het
Taf4 C A 2: 179,932,012 G688C probably damaging Het
Tpte T A 8: 22,365,984 V600E probably damaging Het
Ttn A G 2: 76,821,166 V10953A probably benign Het
Vav2 T C 2: 27,288,679 Y333C probably benign Het
Vav2 A G 2: 27,291,403 S311P probably damaging Het
Zbtb26 A C 2: 37,436,988 M1R probably null Het
Zfp26 G A 9: 20,442,229 P88L probably benign Het
Zfp324 T C 7: 12,970,867 F328L probably damaging Het
Other mutations in Skint4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Skint4 APN 4 112120010 missense possibly damaging 0.86
IGL01654:Skint4 APN 4 112120057 missense probably damaging 0.99
IGL02040:Skint4 APN 4 112146482 splice site probably benign
IGL02328:Skint4 APN 4 112120058 missense possibly damaging 0.92
IGL02811:Skint4 APN 4 112087003 missense possibly damaging 0.86
IGL02965:Skint4 APN 4 112136021 missense probably benign 0.01
IGL03039:Skint4 APN 4 112124650 missense probably benign 0.20
IGL03060:Skint4 APN 4 112118235 missense probably benign 0.33
IGL03075:Skint4 APN 4 112087042 missense probably damaging 1.00
IGL03352:Skint4 APN 4 112165686 missense possibly damaging 0.96
PIT4378001:Skint4 UTSW 4 112087035 missense probably benign 0.01
R0483:Skint4 UTSW 4 112117939 splice site probably benign
R1175:Skint4 UTSW 4 112124596 missense probably benign 0.14
R1446:Skint4 UTSW 4 112118114 missense probably benign 0.11
R1641:Skint4 UTSW 4 112136043 missense possibly damaging 0.93
R1983:Skint4 UTSW 4 112146492 missense probably benign 0.00
R2168:Skint4 UTSW 4 112086986 critical splice acceptor site probably null
R2272:Skint4 UTSW 4 112119868 missense probably benign 0.01
R2287:Skint4 UTSW 4 112118205 missense possibly damaging 0.70
R3801:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R3802:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R3804:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R4009:Skint4 UTSW 4 112120109 missense possibly damaging 0.70
R4564:Skint4 UTSW 4 112119869 missense probably damaging 0.99
R4581:Skint4 UTSW 4 112087042 missense probably damaging 1.00
R4587:Skint4 UTSW 4 112087024 missense probably damaging 0.99
R4674:Skint4 UTSW 4 112118233 missense probably damaging 1.00
R4723:Skint4 UTSW 4 112118236 missense possibly damaging 0.70
R4753:Skint4 UTSW 4 112146531 missense probably benign 0.00
R4775:Skint4 UTSW 4 112136064 missense probably damaging 0.97
R4832:Skint4 UTSW 4 112143766 missense possibly damaging 0.49
R5299:Skint4 UTSW 4 112136006 missense possibly damaging 0.59
R6118:Skint4 UTSW 4 112119822 splice site probably null
R6433:Skint4 UTSW 4 112146510 missense probably benign 0.00
R6616:Skint4 UTSW 4 112118230 missense possibly damaging 0.70
R6698:Skint4 UTSW 4 112119899 missense probably damaging 1.00
R6752:Skint4 UTSW 4 112119863 missense possibly damaging 0.89
R7034:Skint4 UTSW 4 112158084 missense possibly damaging 0.53
R7102:Skint4 UTSW 4 112118101 missense probably damaging 1.00
R7602:Skint4 UTSW 4 112118271 missense possibly damaging 0.50
R8027:Skint4 UTSW 4 112157985 critical splice acceptor site probably null
R8038:Skint4 UTSW 4 112119806 intron probably benign
R8147:Skint4 UTSW 4 112136021 missense probably benign 0.06
R8375:Skint4 UTSW 4 112117976 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACTTAATATTTCAGGATGGTAGGC -3'
(R):5'- TCTGAATCTTTACCAGCAAAAGCAG -3'

Sequencing Primer
(F):5'- CAGGATGGTAGGCTCTTACCAATTG -3'
(R):5'- TCTTTACCAGCAAAAGCAGAGAATG -3'
Posted On2015-04-30