Mutagenetix > Incidental Mutation

Incidental Mutation 'R0388:Cntn3'

31410

Institutional Source

Beutler Lab

Gene Symbol

Cntn3

Ensembl Gene

ENSMUSG00000030075

Gene Name

contactin 3

Synonyms

Pang

MMRRC Submission

038594-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0388 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102162655-102573101 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102277316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 222 (M222V)

Ref Sequence

ENSEMBL: ENSMUSP00000145176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]

AlphaFold

Q07409

Predicted Effect

probably damaging
Transcript: ENSMUST00000032159
AA Change: M222V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075
AA Change: M222V

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	1.85e-7	SMART
IG	129	217	1.82e-6	SMART
IGc2	240	304	6.8e-15	SMART
IGc2	330	393	1.74e-12	SMART
IGc2	422	486	1.53e-8	SMART
IG	506	595	5.2e-11	SMART
FN3	598	684	3.4e-13	SMART
FN3	701	787	5.36e-2	SMART
FN3	803	888	4.63e-6	SMART
FN3	903	983	1.07e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203050

Predicted Effect

probably damaging
Transcript: ENSMUST00000203619
AA Change: M222V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075
AA Change: M222V

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	1.85e-7	SMART
IG	129	217	1.82e-6	SMART
IGc2	240	304	6.8e-15	SMART
IGc2	330	393	1.74e-12	SMART
IGc2	422	486	1.53e-8	SMART
IG	506	595	5.2e-11	SMART
FN3	598	684	3.4e-13	SMART
FN3	701	787	5.36e-2	SMART
FN3	803	888	4.63e-6	SMART
FN3	903	983	1.07e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204857

Meta Mutation Damage Score

0.0914

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.6%
20x: 90.7%

Validation Efficiency

100% (67/67)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,159		probably benign	Het
Acsbg1	T	C	9: 54,609,063	K678R	probably damaging	Het
Adgrg6	A	G	10: 14,450,658	I410T	probably benign	Het
Afap1l2	A	C	19: 56,917,242		probably benign	Het
Aox2	T	C	1: 58,354,406	Y1242H	probably damaging	Het
Apoo-ps	T	C	13: 107,414,673		noncoding transcript	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Cdh3	C	A	8: 106,539,129	T268K	probably damaging	Het
Chd5	T	A	4: 152,371,644	H923Q	probably damaging	Het
Chd7	T	C	4: 8,854,560	V1967A	probably benign	Het
Dcaf17	A	G	2: 71,078,571	K277R	probably benign	Het
Dmbt1	T	C	7: 131,096,049		probably benign	Het
Dmpk	T	A	7: 19,084,077		probably benign	Het
Dzank1	A	T	2: 144,476,106	L714Q	possibly damaging	Het
Efcab3	A	G	11: 105,109,401	D272G	possibly damaging	Het
Erbb2	G	C	11: 98,427,351	R471P	possibly damaging	Het
Esf1	T	A	2: 140,120,871	Y760F	possibly damaging	Het
Fanci	C	A	7: 79,439,630	T938K	probably benign	Het
Gnai3	A	G	3: 108,115,757		probably benign	Het
Hspg2	T	A	4: 137,511,158	C319S	probably damaging	Het
Il12a	T	A	3: 68,695,187		probably null	Het
Inpp4a	A	G	1: 37,396,160	D837G	probably damaging	Het
Kcnj5	T	A	9: 32,317,863	E13V	probably damaging	Het
Kcnq3	T	A	15: 66,000,038	Y594F	probably benign	Het
Kif16b	T	C	2: 142,740,937	E556G	probably damaging	Het
Kif28	T	C	1: 179,740,089	I39V	possibly damaging	Het
Lgi2	T	C	5: 52,554,549	E143G	probably damaging	Het
Mast1	T	G	8: 84,915,537	I1063L	probably benign	Het
Med12l	T	C	3: 59,093,504		probably benign	Het
Mmp19	G	T	10: 128,798,883	R456L	probably benign	Het
Mon1b	T	A	8: 113,639,078	V346E	probably damaging	Het
Mpv17l	A	T	16: 13,940,999	I96L	probably benign	Het
Mrgpra9	A	T	7: 47,252,794	M1K	probably null	Het
Mycbp2	A	T	14: 103,156,667	H2819Q	probably benign	Het
Nav1	A	C	1: 135,448,917		probably benign	Het
Neurl4	T	C	11: 69,911,733		probably benign	Het
Ntng2	G	C	2: 29,207,426	P341R	probably damaging	Het
Oas1d	A	T	5: 120,917,028	Y221F	probably damaging	Het
Olfr1040	A	G	2: 86,146,630	Y35H	probably damaging	Het
Olfr348	C	A	2: 36,786,862	D112E	probably benign	Het
Olfr365	A	C	2: 37,202,184		probably null	Het
Osbpl8	A	G	10: 111,272,282	M380V	probably benign	Het
Pank1	T	C	19: 34,821,706		probably benign	Het
Parn	T	C	16: 13,654,476	D169G	possibly damaging	Het
Pknox1	T	A	17: 31,603,192	I311N	probably damaging	Het
Pprc1	T	C	19: 46,062,775	V248A	possibly damaging	Het
Prkcq	T	C	2: 11,254,234	C322R	probably benign	Het
Ptpn13	T	A	5: 103,555,062	I1298N	probably benign	Het
Rab11fip3	A	G	17: 26,069,072	S36P	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sass6	C	A	3: 116,607,308		probably benign	Het
Shroom3	G	A	5: 92,951,293	G1463D	probably benign	Het
Slc35d1	A	T	4: 103,184,887	Y249*	probably null	Het
Slc9a3	C	T	13: 74,121,536	P8S	unknown	Het
Slc9a9	T	A	9: 94,939,563		probably null	Het
Syne2	T	A	12: 75,986,975	M3666K	probably benign	Het
Synpo2	A	G	3: 123,079,897	V1140A	probably benign	Het
Thada	A	G	17: 84,231,096	F1495L	probably benign	Het
Timeless	A	G	10: 128,241,425		probably null	Het
Tlr6	G	T	5: 64,955,205	H120N	possibly damaging	Het
Tmem173	A	G	18: 35,735,111		probably null	Het
Tns3	T	C	11: 8,445,703	I1234V	probably benign	Het
Ttll9	A	G	2: 153,000,179	S318G	probably benign	Het
Vps13c	T	C	9: 67,922,915		probably benign	Het
Zfp933	T	C	4: 147,826,442	I232M	probably benign	Het
Zfyve27	T	C	19: 42,189,585	S382P	probably damaging	Het

Other mutations in Cntn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Cntn3	APN	6	102420262	nonsense	probably null
IGL00706:Cntn3	APN	6	102203949	missense	probably benign	0.11
IGL01071:Cntn3	APN	6	102420251	critical splice donor site	probably null
IGL01769:Cntn3	APN	6	102208184	missense	probably damaging	1.00
IGL01995:Cntn3	APN	6	102203885	missense	probably damaging	1.00
IGL02058:Cntn3	APN	6	102199360	splice site	probably benign
IGL02736:Cntn3	APN	6	102203939	missense	probably damaging	1.00
IGL02955:Cntn3	APN	6	102278301	missense	probably damaging	1.00
IGL02971:Cntn3	APN	6	102168933	missense	probably damaging	1.00
IGL03208:Cntn3	APN	6	102187099	missense	probably damaging	0.99
P0037:Cntn3	UTSW	6	102209274	missense	probably damaging	1.00
PIT4431001:Cntn3	UTSW	6	102464566	missense	probably benign	0.22
R0314:Cntn3	UTSW	6	102420381	missense	probably damaging	1.00
R0483:Cntn3	UTSW	6	102203966	missense	probably damaging	1.00
R0539:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R0543:Cntn3	UTSW	6	102269090	splice site	probably benign
R0629:Cntn3	UTSW	6	102203976	missense	probably damaging	1.00
R0691:Cntn3	UTSW	6	102168947	missense	possibly damaging	0.48
R0693:Cntn3	UTSW	6	102168947	missense	possibly damaging	0.48
R0781:Cntn3	UTSW	6	102245158	missense	probably benign	0.22
R1110:Cntn3	UTSW	6	102245158	missense	probably benign	0.22
R1144:Cntn3	UTSW	6	102242126	missense	possibly damaging	0.65
R1503:Cntn3	UTSW	6	102464565	nonsense	probably null
R1640:Cntn3	UTSW	6	102242013	missense	possibly damaging	0.82
R1681:Cntn3	UTSW	6	102170668	missense	probably damaging	1.00
R1770:Cntn3	UTSW	6	102269205	missense	possibly damaging	0.49
R1782:Cntn3	UTSW	6	102273811	missense	probably damaging	0.97
R1861:Cntn3	UTSW	6	102245071	missense	probably benign	0.11
R1930:Cntn3	UTSW	6	102242053	nonsense	probably null
R2026:Cntn3	UTSW	6	102420427	missense	probably damaging	1.00
R2152:Cntn3	UTSW	6	102206537	missense	probably damaging	1.00
R2313:Cntn3	UTSW	6	102203928	missense	probably benign
R2351:Cntn3	UTSW	6	102337383	missense	possibly damaging	0.55
R3611:Cntn3	UTSW	6	102208077	missense	possibly damaging	0.77
R4349:Cntn3	UTSW	6	102199351	missense	probably damaging	1.00
R4421:Cntn3	UTSW	6	102464547	missense	probably damaging	0.97
R4513:Cntn3	UTSW	6	102168982	missense	probably benign	0.37
R4678:Cntn3	UTSW	6	102204020	missense	probably damaging	1.00
R4702:Cntn3	UTSW	6	102165331	missense	probably benign	0.37
R4720:Cntn3	UTSW	6	102242022	missense	possibly damaging	0.65
R4879:Cntn3	UTSW	6	102267428	missense	possibly damaging	0.47
R4951:Cntn3	UTSW	6	102169025	missense	possibly damaging	0.90
R5410:Cntn3	UTSW	6	102278353	missense	probably benign	0.01
R5502:Cntn3	UTSW	6	102265334	missense	possibly damaging	0.58
R5852:Cntn3	UTSW	6	102420416	missense	probably damaging	1.00
R5903:Cntn3	UTSW	6	102242133	missense	probably benign	0.00
R6193:Cntn3	UTSW	6	102208131	missense	probably benign	0.31
R6258:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R6260:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R6350:Cntn3	UTSW	6	102170618	missense	probably damaging	1.00
R6490:Cntn3	UTSW	6	102278340	missense	probably damaging	0.99
R6993:Cntn3	UTSW	6	102278404	missense	probably damaging	0.98
R7064:Cntn3	UTSW	6	102273811	missense	probably damaging	0.97
R7085:Cntn3	UTSW	6	102165401	missense	possibly damaging	0.85
R7174:Cntn3	UTSW	6	102165344	missense	probably benign
R7208:Cntn3	UTSW	6	102278422	nonsense	probably null
R7395:Cntn3	UTSW	6	102337394	critical splice acceptor site	probably null
R7447:Cntn3	UTSW	6	102278455	nonsense	probably null
R7571:Cntn3	UTSW	6	102278403	missense	probably damaging	1.00
R7586:Cntn3	UTSW	6	102420427	missense	probably damaging	1.00
R7614:Cntn3	UTSW	6	102165376	missense	probably benign	0.17
R7697:Cntn3	UTSW	6	102208166	missense	probably damaging	1.00
R7697:Cntn3	UTSW	6	102208167	missense	probably damaging	1.00
R7849:Cntn3	UTSW	6	102265431	missense	probably benign	0.00
R8011:Cntn3	UTSW	6	102437899	missense	possibly damaging	0.93
R8013:Cntn3	UTSW	6	102199317	missense	probably benign	0.00
R8377:Cntn3	UTSW	6	102209293	missense	probably benign	0.00
R8726:Cntn3	UTSW	6	102169053	nonsense	probably null
R8770:Cntn3	UTSW	6	102277316	missense	possibly damaging	0.67
R8827:Cntn3	UTSW	6	102269133	missense	probably benign	0.01
R8947:Cntn3	UTSW	6	102437903	missense	probably damaging	1.00
R8997:Cntn3	UTSW	6	102204062	missense	probably damaging	0.98
R9055:Cntn3	UTSW	6	102267437	missense	probably benign	0.38
R9061:Cntn3	UTSW	6	102337327	missense	probably damaging	1.00
R9758:Cntn3	UTSW	6	102206550	missense	probably damaging	1.00
R9762:Cntn3	UTSW	6	102277235	missense	probably damaging	1.00
Z1088:Cntn3	UTSW	6	102420294	missense	possibly damaging	0.74
Z1176:Cntn3	UTSW	6	102437931	critical splice acceptor site	probably null
Z1177:Cntn3	UTSW	6	102337331	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- CATATGACGTGCAAGTGCAAAAGACTG -3'
(R):5'- TGTGACTGGGCTACCATTTAGCAAAAC -3'

Sequencing Primer
(F):5'- TCAAGTCAGGATTAAGGGTTGC -3'
(R):5'- GCATATTGCAGCACTTTTGAC -3'

Posted On

2013-04-24