Mutagenetix > Incidental Mutation

Incidental Mutation 'R4050:Mad1l1'

314103

Institutional Source

Beutler Lab

Gene Symbol

Mad1l1

Ensembl Gene

ENSMUSG00000029554

Gene Name

MAD1 mitotic arrest deficient 1-like 1

Synonyms

Mad1

MMRRC Submission

040968-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4050 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140008689-140321552 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140132816 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 457 (S457P)

Ref Sequence

ENSEMBL: ENSMUSP00000106453 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031534] [ENSMUST00000110829]

AlphaFold

Q9WTX8

Predicted Effect

probably damaging
Transcript: ENSMUST00000031534
AA Change: S457P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031534
Gene: ENSMUSG00000029554
AA Change: S457P

Domain	Start	End	E-Value	Type
Pfam:MAD	54	715	1.6e-272	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110829
AA Change: S457P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106453
Gene: ENSMUSG00000029554
AA Change: S457P

Domain	Start	End	E-Value	Type
Pfam:MAD	2	511	2.5e-198	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199237

Meta Mutation Damage Score

0.3433

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAD1L1 is a component of the mitotic spindle-assembly checkpoint that prevents the onset of anaphase until all chromosome are properly aligned at the metaphase plate. MAD1L1 functions as a homodimer and interacts with MAD2L1. MAD1L1 may play a role in cell cycle control and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele die in utero. Aging heterozygous null mice show increased tumor incidence while heterozygous MEFs are more prone to aneuploidy, induce fibrosarcomas in athymic nude mice, and show a weaker spindle assembly checkpoint-mediated arrest n response to nocodazole. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	A	G	4: 147,944,992	D473G	probably damaging	Het
9530053A07Rik	T	C	7: 28,152,985	V1311A	possibly damaging	Het
Abca1	T	A	4: 53,044,144	Q1826L	probably damaging	Het
Apob	G	A	12: 8,015,390	V4087I	probably benign	Het
Atp10b	G	A	11: 43,259,536	A1354T	probably benign	Het
Baz1a	A	G	12: 54,929,619	V424A	probably benign	Het
Cdc20b	G	A	13: 113,064,285	D180N	probably benign	Het
Cep57l1	G	T	10: 41,729,360	R130S	probably damaging	Het
Ddb1	A	G	19: 10,627,807	D1053G	probably benign	Het
Ddx39	T	A	8: 83,722,234	M246K	probably benign	Het
Dip2a	G	A	10: 76,278,607	T1013M	probably damaging	Het
Edar	G	T	10: 58,609,947	T265N	possibly damaging	Het
Fam207a	T	C	10: 77,514,330	R75G	possibly damaging	Het
Fam208b	A	G	13: 3,573,507	S2148P	probably benign	Het
Gbp8	T	A	5: 105,031,238	I132F	probably damaging	Het
Gga1	A	G	15: 78,891,491	D382G	probably benign	Het
Ggps1	T	C	13: 14,053,699	K300E	probably benign	Het
Gm10518	C	A	1: 179,803,813		probably benign	Het
Gm13078	T	C	4: 143,727,122	S267P	probably benign	Het
Gm8074	G	A	9: 78,322,336		noncoding transcript	Het
H2-Eb1	T	A	17: 34,314,368	L188Q	probably damaging	Het
Heatr6	A	G	11: 83,755,773	S95G	probably damaging	Het
Hnf1a	T	A	5: 114,970,574	N91Y	probably damaging	Het
Ints10	C	T	8: 68,827,351	S710F	probably damaging	Het
Kazn	C	T	4: 142,106,904	E614K	unknown	Het
Kif26a	T	A	12: 112,179,916	M1812K	probably benign	Het
Lmo7	A	T	14: 101,902,277	K488*	probably null	Het
Met	A	G	6: 17,533,984	T645A	probably benign	Het
Mpp4	T	C	1: 59,146,744		probably null	Het
Mycl	A	T	4: 122,996,839		probably null	Het
Ncbp1	G	A	4: 46,147,483	R110H	probably damaging	Het
Nfasc	G	T	1: 132,610,305		probably benign	Het
Nup35	A	G	2: 80,655,976	I212V	probably benign	Het
Olfr1181	A	G	2: 88,423,623	M134T	probably damaging	Het
Olfr1373	T	G	11: 52,145,134	Y132S	probably damaging	Het
Ovgp1	A	G	3: 105,986,596		probably benign	Het
Ovgp1	T	C	3: 105,986,567		probably benign	Het
Pcgf5	G	A	19: 36,442,911	S181N	probably damaging	Het
Plk2	C	T	13: 110,399,866	T617I	probably damaging	Het
Polq	A	T	16: 37,092,820		probably null	Het
Ppp1r1a	A	G	15: 103,532,454	L92P	probably damaging	Het
Prg4	G	C	1: 150,454,759		probably benign	Het
Prune1	T	C	3: 95,262,231	K220R	possibly damaging	Het
Rab3gap2	G	A	1: 185,272,643		probably null	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sall3	G	A	18: 80,971,482	A1005V	probably benign	Het
Samd15	T	G	12: 87,200,632	N30K	probably benign	Het
Scn8a	A	T	15: 101,013,413	K905*	probably null	Het
Scrib	G	A	15: 76,051,473	R1245W	possibly damaging	Het
Skint4	C	T	4: 112,124,614	S260L	probably benign	Het
Slc29a2	A	T	19: 5,029,453	M339L	possibly damaging	Het
Spire1	G	T	18: 67,529,031		probably null	Het
Synpo2	T	C	3: 123,114,278	D463G	possibly damaging	Het
Taf4	C	A	2: 179,932,012	G688C	probably damaging	Het
Tpte	T	A	8: 22,365,984	V600E	probably damaging	Het
Ttn	A	G	2: 76,821,166	V10953A	probably benign	Het
Vav2	T	C	2: 27,288,679	Y333C	probably benign	Het
Vav2	A	G	2: 27,291,403	S311P	probably damaging	Het
Zbtb26	A	C	2: 37,436,988	M1R	probably null	Het
Zfp26	G	A	9: 20,442,229	P88L	probably benign	Het
Zfp324	T	C	7: 12,970,867	F328L	probably damaging	Het

Other mutations in Mad1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01570:Mad1l1	APN	5	140117277	missense	probably benign	0.00
IGL02098:Mad1l1	APN	5	140310589	splice site	probably benign
IGL02100:Mad1l1	APN	5	140143934	missense	probably damaging	1.00
IGL03131:Mad1l1	APN	5	140307703	missense	probably benign	0.18
R0738:Mad1l1	UTSW	5	140300560	missense	probably damaging	1.00
R1902:Mad1l1	UTSW	5	140303688	missense	possibly damaging	0.57
R1989:Mad1l1	UTSW	5	140303670	missense	probably benign	0.27
R2090:Mad1l1	UTSW	5	140009256	missense	probably benign	0.01
R2471:Mad1l1	UTSW	5	140261552	missense	probably benign	0.43
R4049:Mad1l1	UTSW	5	140132816	missense	probably damaging	1.00
R4096:Mad1l1	UTSW	5	140307673	missense	probably benign	0.01
R4682:Mad1l1	UTSW	5	140300252	missense	possibly damaging	0.47
R4729:Mad1l1	UTSW	5	140261511	missense	possibly damaging	0.76
R4838:Mad1l1	UTSW	5	140300262	nonsense	probably null
R5946:Mad1l1	UTSW	5	140261579	missense	probably damaging	1.00
R6088:Mad1l1	UTSW	5	140193963	missense	probably benign	0.13
R6362:Mad1l1	UTSW	5	140315055	missense	possibly damaging	0.71
R6845:Mad1l1	UTSW	5	140009169	missense	probably damaging	1.00
R6957:Mad1l1	UTSW	5	140065817	missense	probably damaging	0.99
R6983:Mad1l1	UTSW	5	140193984	missense	probably damaging	0.99
R7347:Mad1l1	UTSW	5	140144044	missense	probably damaging	1.00
R7807:Mad1l1	UTSW	5	140088786	missense	probably benign	0.01
R8147:Mad1l1	UTSW	5	140143979	missense	probably damaging	1.00
R8165:Mad1l1	UTSW	5	140315058	missense	probably benign
R8545:Mad1l1	UTSW	5	140300494	missense	probably benign	0.04
R8694:Mad1l1	UTSW	5	140088683	missense	probably benign	0.32
R8750:Mad1l1	UTSW	5	140315067	missense	probably benign
R8981:Mad1l1	UTSW	5	140315058	missense	probably benign
R9095:Mad1l1	UTSW	5	140302986	missense	probably damaging	1.00
R9232:Mad1l1	UTSW	5	140105541	missense	probably benign	0.02
R9338:Mad1l1	UTSW	5	140088806	missense	probably damaging	1.00
U24488:Mad1l1	UTSW	5	140315085	missense	probably damaging	1.00
X0026:Mad1l1	UTSW	5	140009205	missense	probably damaging	1.00
Z1177:Mad1l1	UTSW	5	140105582	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- ACAGGAGCGTATGCCTGAAG -3'
(R):5'- ACTAGGATGCAAGATTCAGCTGG -3'

Sequencing Primer
(F):5'- TGAAGGCCAAGTCCTACTGG -3'
(R):5'- GCCCTAACTTGCCCCAGTG -3'

Posted On

2015-04-30