Incidental Mutation 'R4050:Met'
ID314104
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Namemet proto-oncogene
SynonymsPar4, HGF receptor, c-Met
MMRRC Submission 040968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4050 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location17463800-17573980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17533984 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 645 (T645A)
Ref Sequence ENSEMBL: ENSMUSP00000111103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]
Predicted Effect probably benign
Transcript: ENSMUST00000080469
AA Change: T645A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: T645A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115442
AA Change: T645A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: T645A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115443
AA Change: T645A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: T645A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145473
Predicted Effect probably benign
Transcript: ENSMUST00000152802
SMART Domains Protein: ENSMUSP00000118755
Gene: ENSMUSG00000009376

DomainStartEndE-ValueType
IPT 21 116 3.38e-16 SMART
IPT 118 202 4.34e-5 SMART
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,944,992 D473G probably damaging Het
9530053A07Rik T C 7: 28,152,985 V1311A possibly damaging Het
Abca1 T A 4: 53,044,144 Q1826L probably damaging Het
Apob G A 12: 8,015,390 V4087I probably benign Het
Atp10b G A 11: 43,259,536 A1354T probably benign Het
Baz1a A G 12: 54,929,619 V424A probably benign Het
Cdc20b G A 13: 113,064,285 D180N probably benign Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Ddb1 A G 19: 10,627,807 D1053G probably benign Het
Ddx39 T A 8: 83,722,234 M246K probably benign Het
Dip2a G A 10: 76,278,607 T1013M probably damaging Het
Edar G T 10: 58,609,947 T265N possibly damaging Het
Fam207a T C 10: 77,514,330 R75G possibly damaging Het
Fam208b A G 13: 3,573,507 S2148P probably benign Het
Gbp8 T A 5: 105,031,238 I132F probably damaging Het
Gga1 A G 15: 78,891,491 D382G probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm10518 C A 1: 179,803,813 probably benign Het
Gm13078 T C 4: 143,727,122 S267P probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
H2-Eb1 T A 17: 34,314,368 L188Q probably damaging Het
Heatr6 A G 11: 83,755,773 S95G probably damaging Het
Hnf1a T A 5: 114,970,574 N91Y probably damaging Het
Ints10 C T 8: 68,827,351 S710F probably damaging Het
Kazn C T 4: 142,106,904 E614K unknown Het
Kif26a T A 12: 112,179,916 M1812K probably benign Het
Lmo7 A T 14: 101,902,277 K488* probably null Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Mpp4 T C 1: 59,146,744 probably null Het
Mycl A T 4: 122,996,839 probably null Het
Ncbp1 G A 4: 46,147,483 R110H probably damaging Het
Nfasc G T 1: 132,610,305 probably benign Het
Nup35 A G 2: 80,655,976 I212V probably benign Het
Olfr1181 A G 2: 88,423,623 M134T probably damaging Het
Olfr1373 T G 11: 52,145,134 Y132S probably damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcgf5 G A 19: 36,442,911 S181N probably damaging Het
Plk2 C T 13: 110,399,866 T617I probably damaging Het
Polq A T 16: 37,092,820 probably null Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Prune1 T C 3: 95,262,231 K220R possibly damaging Het
Rab3gap2 G A 1: 185,272,643 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall3 G A 18: 80,971,482 A1005V probably benign Het
Samd15 T G 12: 87,200,632 N30K probably benign Het
Scn8a A T 15: 101,013,413 K905* probably null Het
Scrib G A 15: 76,051,473 R1245W possibly damaging Het
Skint4 C T 4: 112,124,614 S260L probably benign Het
Slc29a2 A T 19: 5,029,453 M339L possibly damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Synpo2 T C 3: 123,114,278 D463G possibly damaging Het
Taf4 C A 2: 179,932,012 G688C probably damaging Het
Tpte T A 8: 22,365,984 V600E probably damaging Het
Ttn A G 2: 76,821,166 V10953A probably benign Het
Vav2 T C 2: 27,288,679 Y333C probably benign Het
Vav2 A G 2: 27,291,403 S311P probably damaging Het
Zbtb26 A C 2: 37,436,988 M1R probably null Het
Zfp26 G A 9: 20,442,229 P88L probably benign Het
Zfp324 T C 7: 12,970,867 F328L probably damaging Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1553:Met UTSW 6 17491461 missense probably benign 0.01
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2419:Met UTSW 6 17535830 splice site probably benign
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4855:Met UTSW 6 17558797 missense probably damaging 1.00
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R4902:Met UTSW 6 17546996 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5683:Met UTSW 6 17571744 missense probably damaging 1.00
R5872:Met UTSW 6 17562198 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6063:Met UTSW 6 17491968 missense probably damaging 1.00
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
R7770:Met UTSW 6 17491407 missense possibly damaging 0.79
R7797:Met UTSW 6 17533953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGAGCTCACAATTTGGGG -3'
(R):5'- TTTCCCAGTAAGAGTGAGTAAGGTG -3'

Sequencing Primer
(F):5'- GGGGTTTAATATCCCATCACAAC -3'
(R):5'- AGTGAGTAAGGTGCCTCCAGC -3'
Posted On2015-04-30