Incidental Mutation 'R4050:Olfr1373'
ID 314119
Institutional Source Beutler Lab
Gene Symbol Olfr1373
Ensembl Gene ENSMUSG00000062204
Gene Name olfactory receptor 1373
Synonyms MOR256-69_p, GA_x6K02T2QP88-3283154-3284089
MMRRC Submission 040968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4050 (G1)
Quality Score 179
Status Not validated
Chromosome 11
Chromosomal Location 52144593-52145528 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 52145134 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 132 (Y132S)
Ref Sequence ENSEMBL: ENSMUSP00000077384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078264]
AlphaFold Q7TQT6
Predicted Effect probably damaging
Transcript: ENSMUST00000078264
AA Change: Y132S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077384
Gene: ENSMUSG00000062204
AA Change: Y132S

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.7e-46 PFAM
Pfam:7tm_1 41 289 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,944,992 D473G probably damaging Het
9530053A07Rik T C 7: 28,152,985 V1311A possibly damaging Het
Abca1 T A 4: 53,044,144 Q1826L probably damaging Het
Apob G A 12: 8,015,390 V4087I probably benign Het
Atp10b G A 11: 43,259,536 A1354T probably benign Het
Baz1a A G 12: 54,929,619 V424A probably benign Het
Cdc20b G A 13: 113,064,285 D180N probably benign Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Ddb1 A G 19: 10,627,807 D1053G probably benign Het
Ddx39 T A 8: 83,722,234 M246K probably benign Het
Dip2a G A 10: 76,278,607 T1013M probably damaging Het
Edar G T 10: 58,609,947 T265N possibly damaging Het
Fam207a T C 10: 77,514,330 R75G possibly damaging Het
Fam208b A G 13: 3,573,507 S2148P probably benign Het
Gbp8 T A 5: 105,031,238 I132F probably damaging Het
Gga1 A G 15: 78,891,491 D382G probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm10518 C A 1: 179,803,813 probably benign Het
Gm13078 T C 4: 143,727,122 S267P probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
H2-Eb1 T A 17: 34,314,368 L188Q probably damaging Het
Heatr6 A G 11: 83,755,773 S95G probably damaging Het
Hnf1a T A 5: 114,970,574 N91Y probably damaging Het
Ints10 C T 8: 68,827,351 S710F probably damaging Het
Kazn C T 4: 142,106,904 E614K unknown Het
Kif26a T A 12: 112,179,916 M1812K probably benign Het
Lmo7 A T 14: 101,902,277 K488* probably null Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Met A G 6: 17,533,984 T645A probably benign Het
Mpp4 T C 1: 59,146,744 probably null Het
Mycl A T 4: 122,996,839 probably null Het
Ncbp1 G A 4: 46,147,483 R110H probably damaging Het
Nfasc G T 1: 132,610,305 probably benign Het
Nup35 A G 2: 80,655,976 I212V probably benign Het
Olfr1181 A G 2: 88,423,623 M134T probably damaging Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcgf5 G A 19: 36,442,911 S181N probably damaging Het
Plk2 C T 13: 110,399,866 T617I probably damaging Het
Polq A T 16: 37,092,820 probably null Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Prune1 T C 3: 95,262,231 K220R possibly damaging Het
Rab3gap2 G A 1: 185,272,643 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall3 G A 18: 80,971,482 A1005V probably benign Het
Samd15 T G 12: 87,200,632 N30K probably benign Het
Scn8a A T 15: 101,013,413 K905* probably null Het
Scrib G A 15: 76,051,473 R1245W possibly damaging Het
Skint4 C T 4: 112,124,614 S260L probably benign Het
Slc29a2 A T 19: 5,029,453 M339L possibly damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Synpo2 T C 3: 123,114,278 D463G possibly damaging Het
Taf4 C A 2: 179,932,012 G688C probably damaging Het
Tpte T A 8: 22,365,984 V600E probably damaging Het
Ttn A G 2: 76,821,166 V10953A probably benign Het
Vav2 T C 2: 27,288,679 Y333C probably benign Het
Vav2 A G 2: 27,291,403 S311P probably damaging Het
Zbtb26 A C 2: 37,436,988 M1R probably null Het
Zfp26 G A 9: 20,442,229 P88L probably benign Het
Zfp324 T C 7: 12,970,867 F328L probably damaging Het
Other mutations in Olfr1373
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02277:Olfr1373 APN 11 52145362 missense probably damaging 0.97
IGL02814:Olfr1373 APN 11 52144810 missense probably damaging 1.00
R0490:Olfr1373 UTSW 11 52144666 missense probably damaging 1.00
R1075:Olfr1373 UTSW 11 52144850 missense possibly damaging 0.94
R5666:Olfr1373 UTSW 11 52144698 nonsense probably null
R6267:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6296:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6720:Olfr1373 UTSW 11 52144693 missense probably benign 0.18
R6887:Olfr1373 UTSW 11 52145352 missense probably benign 0.01
R8797:Olfr1373 UTSW 11 52145513 missense probably benign 0.05
V1662:Olfr1373 UTSW 11 52145177 missense probably damaging 1.00
X0066:Olfr1373 UTSW 11 52145264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGGCCATCTTCAGGAGAACAG -3'
(R):5'- GCCTGCACACACTCATGTAC -3'

Sequencing Primer
(F):5'- CATCTTCAGGAGAACAGGTAGCTC -3'
(R):5'- TGGACCTCTGCTACACCG -3'
Posted On 2015-04-30