Incidental Mutation 'R0388:Fanci'
ID 31412
Institutional Source Beutler Lab
Gene Symbol Fanci
Ensembl Gene ENSMUSG00000039187
Gene Name Fanconi anemia, complementation group I
Synonyms
MMRRC Submission 038594-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.651) question?
Stock # R0388 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 79042056-79100013 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 79089378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 938 (T938K)
Ref Sequence ENSEMBL: ENSMUSP00000044931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000132091] [ENSMUST00000137667]
AlphaFold Q8K368
PDB Structure Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]
Structure of a Y DNA-FANCI complex [X-RAY DIFFRACTION]
Structure of FANCI [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000036865
AA Change: T938K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187
AA Change: T938K

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137667
SMART Domains Protein: ENSMUSP00000117992
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 25 7.2e-11 PFAM
Pfam:FANCI_S1 32 253 3.4e-80 PFAM
Pfam:FANCI_HD1 256 343 7.3e-37 PFAM
Pfam:FANCI_S2 349 513 8.5e-56 PFAM
Pfam:FANCI_HD2 523 758 9.3e-99 PFAM
Pfam:FANCI_S3 775 850 1.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206121
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
Acsbg1 T C 9: 54,516,347 (GRCm39) K678R probably damaging Het
Adgrg6 A G 10: 14,326,402 (GRCm39) I410T probably benign Het
Afap1l2 A C 19: 56,905,674 (GRCm39) probably benign Het
Aox1 T C 1: 58,393,565 (GRCm39) Y1242H probably damaging Het
Apoo-ps T C 13: 107,551,173 (GRCm39) noncoding transcript Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Cdh3 C A 8: 107,265,761 (GRCm39) T268K probably damaging Het
Chd5 T A 4: 152,456,101 (GRCm39) H923Q probably damaging Het
Chd7 T C 4: 8,854,560 (GRCm39) V1967A probably benign Het
Cntn3 T C 6: 102,254,277 (GRCm39) M222V probably damaging Het
Dcaf17 A G 2: 70,908,915 (GRCm39) K277R probably benign Het
Dmbt1 T C 7: 130,697,779 (GRCm39) probably benign Het
Dmpk T A 7: 18,818,002 (GRCm39) probably benign Het
Dzank1 A T 2: 144,318,026 (GRCm39) L714Q possibly damaging Het
Efcab3 A G 11: 105,000,227 (GRCm39) D272G possibly damaging Het
Erbb2 G C 11: 98,318,177 (GRCm39) R471P possibly damaging Het
Esf1 T A 2: 139,962,791 (GRCm39) Y760F possibly damaging Het
Gnai3 A G 3: 108,023,073 (GRCm39) probably benign Het
Hspg2 T A 4: 137,238,469 (GRCm39) C319S probably damaging Het
Il12a T A 3: 68,602,520 (GRCm39) probably null Het
Inpp4a A G 1: 37,435,241 (GRCm39) D837G probably damaging Het
Kcnj5 T A 9: 32,229,159 (GRCm39) E13V probably damaging Het
Kcnq3 T A 15: 65,871,887 (GRCm39) Y594F probably benign Het
Kif16b T C 2: 142,582,857 (GRCm39) E556G probably damaging Het
Kif28 T C 1: 179,567,654 (GRCm39) I39V possibly damaging Het
Lgi2 T C 5: 52,711,891 (GRCm39) E143G probably damaging Het
Mast1 T G 8: 85,642,166 (GRCm39) I1063L probably benign Het
Med12l T C 3: 59,000,925 (GRCm39) probably benign Het
Mmp19 G T 10: 128,634,752 (GRCm39) R456L probably benign Het
Mon1b T A 8: 114,365,710 (GRCm39) V346E probably damaging Het
Mpv17l A T 16: 13,758,863 (GRCm39) I96L probably benign Het
Mrgpra9 A T 7: 46,902,542 (GRCm39) M1K probably null Het
Mycbp2 A T 14: 103,394,103 (GRCm39) H2819Q probably benign Het
Nav1 A C 1: 135,376,655 (GRCm39) probably benign Het
Neurl4 T C 11: 69,802,559 (GRCm39) probably benign Het
Ntng2 G C 2: 29,097,438 (GRCm39) P341R probably damaging Het
Oas1d A T 5: 121,055,091 (GRCm39) Y221F probably damaging Het
Or1j19 C A 2: 36,676,874 (GRCm39) D112E probably benign Het
Or1l4 A C 2: 37,092,196 (GRCm39) probably null Het
Or5al6 A G 2: 85,976,974 (GRCm39) Y35H probably damaging Het
Osbpl8 A G 10: 111,108,143 (GRCm39) M380V probably benign Het
Pank1 T C 19: 34,799,106 (GRCm39) probably benign Het
Parn T C 16: 13,472,340 (GRCm39) D169G possibly damaging Het
Pknox1 T A 17: 31,822,166 (GRCm39) I311N probably damaging Het
Pprc1 T C 19: 46,051,214 (GRCm39) V248A possibly damaging Het
Prkcq T C 2: 11,259,045 (GRCm39) C322R probably benign Het
Ptpn13 T A 5: 103,702,928 (GRCm39) I1298N probably benign Het
Rab11fip3 A G 17: 26,288,046 (GRCm39) S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Sass6 C A 3: 116,400,957 (GRCm39) probably benign Het
Shroom3 G A 5: 93,099,152 (GRCm39) G1463D probably benign Het
Slc35d1 A T 4: 103,042,084 (GRCm39) Y249* probably null Het
Slc9a3 C T 13: 74,269,655 (GRCm39) P8S unknown Het
Slc9a9 T A 9: 94,821,616 (GRCm39) probably null Het
Sting1 A G 18: 35,868,164 (GRCm39) probably null Het
Syne2 T A 12: 76,033,749 (GRCm39) M3666K probably benign Het
Synpo2 A G 3: 122,873,546 (GRCm39) V1140A probably benign Het
Thada A G 17: 84,538,524 (GRCm39) F1495L probably benign Het
Timeless A G 10: 128,077,294 (GRCm39) probably null Het
Tlr6 G T 5: 65,112,548 (GRCm39) H120N possibly damaging Het
Tns3 T C 11: 8,395,703 (GRCm39) I1234V probably benign Het
Ttll9 A G 2: 152,842,099 (GRCm39) S318G probably benign Het
Vps13c T C 9: 67,830,197 (GRCm39) probably benign Het
Zfp933 T C 4: 147,910,899 (GRCm39) I232M probably benign Het
Zfyve27 T C 19: 42,178,024 (GRCm39) S382P probably damaging Het
Other mutations in Fanci
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Fanci APN 7 79,062,448 (GRCm39) missense probably damaging 1.00
IGL00718:Fanci APN 7 79,093,922 (GRCm39) missense possibly damaging 0.92
IGL00764:Fanci APN 7 79,045,660 (GRCm39) start codon destroyed probably null 0.05
IGL01669:Fanci APN 7 79,098,925 (GRCm39) missense probably benign 0.01
IGL02338:Fanci APN 7 79,083,279 (GRCm39) nonsense probably null
IGL02428:Fanci APN 7 79,094,264 (GRCm39) intron probably benign
IGL03029:Fanci APN 7 79,093,747 (GRCm39) missense probably benign 0.00
BB005:Fanci UTSW 7 79,094,459 (GRCm39) missense probably benign
BB015:Fanci UTSW 7 79,094,459 (GRCm39) missense probably benign
P0023:Fanci UTSW 7 79,052,048 (GRCm39) missense probably benign 0.00
P0047:Fanci UTSW 7 79,093,792 (GRCm39) missense probably damaging 1.00
R0310:Fanci UTSW 7 79,057,165 (GRCm39) splice site probably benign
R0506:Fanci UTSW 7 79,081,926 (GRCm39) missense probably benign 0.29
R0570:Fanci UTSW 7 79,093,711 (GRCm39) missense probably damaging 1.00
R0631:Fanci UTSW 7 79,055,953 (GRCm39) missense probably damaging 1.00
R0746:Fanci UTSW 7 79,089,429 (GRCm39) missense probably damaging 0.99
R0981:Fanci UTSW 7 79,054,914 (GRCm39) missense probably benign 0.01
R1559:Fanci UTSW 7 79,082,941 (GRCm39) missense probably damaging 1.00
R1656:Fanci UTSW 7 79,054,936 (GRCm39) splice site probably benign
R1748:Fanci UTSW 7 79,080,236 (GRCm39) missense probably damaging 1.00
R1815:Fanci UTSW 7 79,088,056 (GRCm39) missense probably damaging 1.00
R2164:Fanci UTSW 7 79,045,743 (GRCm39) missense probably benign 0.22
R3508:Fanci UTSW 7 79,083,220 (GRCm39) missense probably benign 0.01
R3908:Fanci UTSW 7 79,083,257 (GRCm39) missense possibly damaging 0.91
R4036:Fanci UTSW 7 79,094,570 (GRCm39) missense probably damaging 1.00
R4066:Fanci UTSW 7 79,062,505 (GRCm39) critical splice donor site probably null
R4633:Fanci UTSW 7 79,076,990 (GRCm39) missense probably damaging 1.00
R4651:Fanci UTSW 7 79,085,004 (GRCm39) missense possibly damaging 0.74
R4993:Fanci UTSW 7 79,085,126 (GRCm39) makesense probably null
R5341:Fanci UTSW 7 79,055,926 (GRCm39) missense probably damaging 1.00
R5806:Fanci UTSW 7 79,098,596 (GRCm39) missense probably damaging 0.97
R5898:Fanci UTSW 7 79,083,069 (GRCm39) missense probably benign
R5919:Fanci UTSW 7 79,094,486 (GRCm39) missense probably damaging 1.00
R5960:Fanci UTSW 7 79,093,510 (GRCm39) missense probably damaging 1.00
R6367:Fanci UTSW 7 79,075,943 (GRCm39) missense probably damaging 0.99
R6436:Fanci UTSW 7 79,090,446 (GRCm39) missense probably benign 0.03
R6468:Fanci UTSW 7 79,067,687 (GRCm39) missense probably benign 0.10
R6508:Fanci UTSW 7 79,093,516 (GRCm39) missense probably damaging 0.99
R6886:Fanci UTSW 7 79,070,090 (GRCm39) missense possibly damaging 0.81
R7554:Fanci UTSW 7 79,062,500 (GRCm39) missense probably damaging 0.99
R7588:Fanci UTSW 7 79,084,017 (GRCm39) missense possibly damaging 0.81
R7644:Fanci UTSW 7 79,094,219 (GRCm39) nonsense probably null
R7697:Fanci UTSW 7 79,056,040 (GRCm39) critical splice donor site probably null
R7732:Fanci UTSW 7 79,062,400 (GRCm39) missense possibly damaging 0.65
R7928:Fanci UTSW 7 79,094,459 (GRCm39) missense probably benign
R8170:Fanci UTSW 7 79,083,305 (GRCm39) splice site probably null
R8355:Fanci UTSW 7 79,085,029 (GRCm39) missense probably damaging 1.00
R8425:Fanci UTSW 7 79,083,289 (GRCm39) missense probably benign 0.07
R8429:Fanci UTSW 7 79,088,133 (GRCm39) missense possibly damaging 0.65
R8455:Fanci UTSW 7 79,085,029 (GRCm39) missense probably damaging 1.00
R8720:Fanci UTSW 7 79,089,425 (GRCm39) missense possibly damaging 0.92
R8786:Fanci UTSW 7 79,052,298 (GRCm39) missense probably benign 0.02
R8946:Fanci UTSW 7 79,045,726 (GRCm39) missense probably benign 0.03
R8986:Fanci UTSW 7 79,095,472 (GRCm39) missense probably benign 0.03
R9213:Fanci UTSW 7 79,055,971 (GRCm39) missense possibly damaging 0.70
R9333:Fanci UTSW 7 79,067,594 (GRCm39) missense possibly damaging 0.47
R9485:Fanci UTSW 7 79,089,405 (GRCm39) missense probably benign 0.10
R9508:Fanci UTSW 7 79,083,033 (GRCm39) missense possibly damaging 0.89
R9624:Fanci UTSW 7 79,085,117 (GRCm39) missense probably benign 0.12
R9649:Fanci UTSW 7 79,076,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATTTAAGTCAGCCTCCAGACCTTTT -3'
(R):5'- TCCAGACATACCACCTTTCACTCAGAT -3'

Sequencing Primer
(F):5'- gtccttgtagcagtttctaaagtc -3'
(R):5'- AGATCTGCCTGCACTTCCTG -3'
Posted On 2013-04-24