Incidental Mutation 'R4050:Heatr6'
ID 314120
Institutional Source Beutler Lab
Gene Symbol Heatr6
Ensembl Gene ENSMUSG00000000976
Gene Name HEAT repeat containing 6
Synonyms 2700008B19Rik
MMRRC Submission 040968-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.886) question?
Stock # R4050 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 83644522-83674580 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83646599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 95 (S95G)
Ref Sequence ENSEMBL: ENSMUSP00000001002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001002] [ENSMUST00000070832]
AlphaFold Q6P1G0
Predicted Effect probably damaging
Transcript: ENSMUST00000001002
AA Change: S95G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001002
Gene: ENSMUSG00000000976
AA Change: S95G

DomainStartEndE-ValueType
low complexity region 160 174 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
low complexity region 329 348 N/A INTRINSIC
low complexity region 391 402 N/A INTRINSIC
Pfam:DUF4042 421 602 9.6e-73 PFAM
low complexity region 603 627 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 1078 1091 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070832
SMART Domains Protein: ENSMUSP00000064479
Gene: ENSMUSG00000051748

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Blast:WAP 23 63 4e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127428
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 148,029,449 (GRCm39) D473G probably damaging Het
Abca1 T A 4: 53,044,144 (GRCm39) Q1826L probably damaging Het
Apob G A 12: 8,065,390 (GRCm39) V4087I probably benign Het
Atp10b G A 11: 43,150,363 (GRCm39) A1354T probably benign Het
Baz1a A G 12: 54,976,404 (GRCm39) V424A probably benign Het
Cdc20b G A 13: 113,200,819 (GRCm39) D180N probably benign Het
Cep57l1 G T 10: 41,605,356 (GRCm39) R130S probably damaging Het
Ddb1 A G 19: 10,605,171 (GRCm39) D1053G probably benign Het
Ddx39a T A 8: 84,448,863 (GRCm39) M246K probably benign Het
Dip2a G A 10: 76,114,441 (GRCm39) T1013M probably damaging Het
Edar G T 10: 58,445,769 (GRCm39) T265N possibly damaging Het
Fcgbpl1 T C 7: 27,852,410 (GRCm39) V1311A possibly damaging Het
Gbp8 T A 5: 105,179,104 (GRCm39) I132F probably damaging Het
Gga1 A G 15: 78,775,691 (GRCm39) D382G probably benign Het
Ggps1 T C 13: 14,228,284 (GRCm39) K300E probably benign Het
Gm10518 C A 1: 179,631,378 (GRCm39) probably benign Het
Gm8074 G A 9: 78,229,618 (GRCm39) noncoding transcript Het
H2-Eb1 T A 17: 34,533,342 (GRCm39) L188Q probably damaging Het
Hnf1a T A 5: 115,108,633 (GRCm39) N91Y probably damaging Het
Ints10 C T 8: 69,280,003 (GRCm39) S710F probably damaging Het
Kazn C T 4: 141,834,215 (GRCm39) E614K unknown Het
Kif26a T A 12: 112,146,350 (GRCm39) M1812K probably benign Het
Lmo7 A T 14: 102,139,713 (GRCm39) K488* probably null Het
Mad1l1 A G 5: 140,118,571 (GRCm39) S457P probably damaging Het
Met A G 6: 17,533,983 (GRCm39) T645A probably benign Het
Mpp4 T C 1: 59,185,903 (GRCm39) probably null Het
Mycl A T 4: 122,890,632 (GRCm39) probably null Het
Ncbp1 G A 4: 46,147,483 (GRCm39) R110H probably damaging Het
Nfasc G T 1: 132,538,043 (GRCm39) probably benign Het
Nup35 A G 2: 80,486,320 (GRCm39) I212V probably benign Het
Or2y8 T G 11: 52,035,961 (GRCm39) Y132S probably damaging Het
Or4p20 A G 2: 88,253,967 (GRCm39) M134T probably damaging Het
Ovgp1 T C 3: 105,893,883 (GRCm39) probably benign Het
Ovgp1 A G 3: 105,893,912 (GRCm39) probably benign Het
Pcgf5 G A 19: 36,420,311 (GRCm39) S181N probably damaging Het
Plk2 C T 13: 110,536,400 (GRCm39) T617I probably damaging Het
Polq A T 16: 36,913,182 (GRCm39) probably null Het
Ppp1r1a A G 15: 103,440,881 (GRCm39) L92P probably damaging Het
Pramel24 T C 4: 143,453,692 (GRCm39) S267P probably benign Het
Prg4 G C 1: 150,330,510 (GRCm39) probably benign Het
Prune1 T C 3: 95,169,542 (GRCm39) K220R possibly damaging Het
Rab3gap2 G A 1: 185,004,840 (GRCm39) probably null Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sall3 G A 18: 81,014,697 (GRCm39) A1005V probably benign Het
Samd15 T G 12: 87,247,406 (GRCm39) N30K probably benign Het
Scn8a A T 15: 100,911,294 (GRCm39) K905* probably null Het
Scrib G A 15: 75,923,322 (GRCm39) R1245W possibly damaging Het
Skint4 C T 4: 111,981,811 (GRCm39) S260L probably benign Het
Slc29a2 A T 19: 5,079,481 (GRCm39) M339L possibly damaging Het
Slx9 T C 10: 77,350,164 (GRCm39) R75G possibly damaging Het
Spire1 G T 18: 67,662,101 (GRCm39) probably null Het
Synpo2 T C 3: 122,907,927 (GRCm39) D463G possibly damaging Het
Taf4 C A 2: 179,573,805 (GRCm39) G688C probably damaging Het
Tasor2 A G 13: 3,623,507 (GRCm39) S2148P probably benign Het
Tpte T A 8: 22,856,000 (GRCm39) V600E probably damaging Het
Ttn A G 2: 76,651,510 (GRCm39) V10953A probably benign Het
Vav2 T C 2: 27,178,691 (GRCm39) Y333C probably benign Het
Vav2 A G 2: 27,181,415 (GRCm39) S311P probably damaging Het
Zbtb26 A C 2: 37,327,000 (GRCm39) M1R probably null Het
Zfp26 G A 9: 20,353,525 (GRCm39) P88L probably benign Het
Zfp324 T C 7: 12,704,794 (GRCm39) F328L probably damaging Het
Other mutations in Heatr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Heatr6 APN 11 83,650,135 (GRCm39) missense probably damaging 1.00
IGL01681:Heatr6 APN 11 83,655,826 (GRCm39) missense probably benign 0.08
IGL01905:Heatr6 APN 11 83,672,538 (GRCm39) missense probably benign 0.06
IGL02037:Heatr6 APN 11 83,655,708 (GRCm39) splice site probably benign
IGL02313:Heatr6 APN 11 83,669,718 (GRCm39) missense probably damaging 1.00
IGL02652:Heatr6 APN 11 83,660,558 (GRCm39) missense probably damaging 1.00
IGL03004:Heatr6 APN 11 83,648,205 (GRCm39) missense probably benign 0.01
IGL03229:Heatr6 APN 11 83,672,271 (GRCm39) missense probably benign 0.01
IGL03386:Heatr6 APN 11 83,650,203 (GRCm39) missense probably damaging 1.00
IGL02802:Heatr6 UTSW 11 83,651,762 (GRCm39) missense probably damaging 1.00
R0537:Heatr6 UTSW 11 83,670,290 (GRCm39) nonsense probably null
R1658:Heatr6 UTSW 11 83,649,193 (GRCm39) missense probably damaging 1.00
R1864:Heatr6 UTSW 11 83,660,056 (GRCm39) missense probably damaging 0.97
R1893:Heatr6 UTSW 11 83,648,140 (GRCm39) missense probably benign 0.33
R1944:Heatr6 UTSW 11 83,660,046 (GRCm39) missense probably damaging 1.00
R2115:Heatr6 UTSW 11 83,648,281 (GRCm39) unclassified probably benign
R3019:Heatr6 UTSW 11 83,669,658 (GRCm39) splice site probably null
R4532:Heatr6 UTSW 11 83,660,498 (GRCm39) missense probably damaging 1.00
R4576:Heatr6 UTSW 11 83,655,826 (GRCm39) missense probably benign 0.08
R4724:Heatr6 UTSW 11 83,670,374 (GRCm39) nonsense probably null
R4825:Heatr6 UTSW 11 83,649,148 (GRCm39) missense probably damaging 1.00
R5489:Heatr6 UTSW 11 83,665,258 (GRCm39) missense probably damaging 1.00
R5970:Heatr6 UTSW 11 83,644,544 (GRCm39) unclassified probably benign
R6136:Heatr6 UTSW 11 83,663,329 (GRCm39) missense possibly damaging 0.94
R6145:Heatr6 UTSW 11 83,656,962 (GRCm39) missense probably damaging 1.00
R6649:Heatr6 UTSW 11 83,650,191 (GRCm39) missense probably benign 0.01
R6653:Heatr6 UTSW 11 83,650,191 (GRCm39) missense probably benign 0.01
R6791:Heatr6 UTSW 11 83,649,167 (GRCm39) missense probably benign
R6865:Heatr6 UTSW 11 83,659,966 (GRCm39) missense probably damaging 1.00
R7154:Heatr6 UTSW 11 83,668,067 (GRCm39) missense probably benign 0.05
R7385:Heatr6 UTSW 11 83,650,161 (GRCm39) missense probably damaging 0.96
R7473:Heatr6 UTSW 11 83,672,217 (GRCm39) missense probably damaging 1.00
R7959:Heatr6 UTSW 11 83,672,189 (GRCm39) nonsense probably null
R8034:Heatr6 UTSW 11 83,644,735 (GRCm39) missense probably benign 0.01
R8202:Heatr6 UTSW 11 83,650,234 (GRCm39) missense possibly damaging 0.53
R8398:Heatr6 UTSW 11 83,672,164 (GRCm39) missense probably benign 0.01
R8472:Heatr6 UTSW 11 83,656,679 (GRCm39) missense probably benign 0.34
R8704:Heatr6 UTSW 11 83,668,104 (GRCm39) missense probably benign 0.09
R9604:Heatr6 UTSW 11 83,668,188 (GRCm39) missense probably damaging 0.99
X0014:Heatr6 UTSW 11 83,672,076 (GRCm39) missense probably damaging 0.97
Z1177:Heatr6 UTSW 11 83,672,208 (GRCm39) missense probably damaging 1.00
Z1177:Heatr6 UTSW 11 83,656,907 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGGAACAGTCAGTGAGC -3'
(R):5'- ACTGACTTGGGTGTAGCAAC -3'

Sequencing Primer
(F):5'- AACAGTCAGTGAGCTTTTCCG -3'
(R):5'- CTTGGGTGTAGCAACAAACATCTGC -3'
Posted On 2015-04-30