Mutagenetix > Incidental Mutations

Incidental Mutation 'R4050:Spire1'

314138

Institutional Source

Beutler Lab

Gene Symbol

Spire1

Ensembl Gene

ENSMUSG00000024533

Gene Name

spire type actin nucleation factor 1

Synonyms

6030430B19Rik, Spir-1

MMRRC Submission

040968-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.224) question?

Stock #

R4050 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67488209-67610790 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 67529031 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]

Predicted Effect

probably null
Transcript: ENSMUST00000045105

SMART Domains

Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533

Domain	Start	End	E-Value	Type
Pfam:KIND	1	78	3.3e-27	PFAM
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	289	316	N/A	INTRINSIC
low complexity region	339	350	N/A	INTRINSIC
SCOP:d1zbdb_	445	518	1e-7	SMART
low complexity region	596	606	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000082243

SMART Domains

Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533

Domain	Start	End	E-Value	Type
Blast:KIND	1	73	2e-26	BLAST
PDB:3RBW\|D	1	79	3e-28	PDB
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	302	329	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
SCOP:d1zbdb_	400	473	2e-7	SMART
low complexity region	551	561	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115050

SMART Domains

Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533

Domain	Start	End	E-Value	Type
PDB:4EFH\|B	106	162	9e-6	PDB
low complexity region	219	246	N/A	INTRINSIC
low complexity region	269	280	N/A	INTRINSIC
SCOP:d1zbdb_	317	390	4e-7	SMART
low complexity region	468	478	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000224799

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	A	G	4: 147,944,992	D473G	probably damaging	Het
9530053A07Rik	T	C	7: 28,152,985	V1311A	possibly damaging	Het
Abca1	T	A	4: 53,044,144	Q1826L	probably damaging	Het
Apob	G	A	12: 8,015,390	V4087I	probably benign	Het
Atp10b	G	A	11: 43,259,536	A1354T	probably benign	Het
Baz1a	A	G	12: 54,929,619	V424A	probably benign	Het
Cdc20b	G	A	13: 113,064,285	D180N	probably benign	Het
Cep57l1	G	T	10: 41,729,360	R130S	probably damaging	Het
Ddb1	A	G	19: 10,627,807	D1053G	probably benign	Het
Ddx39	T	A	8: 83,722,234	M246K	probably benign	Het
Dip2a	G	A	10: 76,278,607	T1013M	probably damaging	Het
Edar	G	T	10: 58,609,947	T265N	possibly damaging	Het
Fam207a	T	C	10: 77,514,330	R75G	possibly damaging	Het
Fam208b	A	G	13: 3,573,507	S2148P	probably benign	Het
Gbp8	T	A	5: 105,031,238	I132F	probably damaging	Het
Gga1	A	G	15: 78,891,491	D382G	probably benign	Het
Ggps1	T	C	13: 14,053,699	K300E	probably benign	Het
Gm10518	C	A	1: 179,803,813		probably benign	Het
Gm13078	T	C	4: 143,727,122	S267P	probably benign	Het
Gm8074	G	A	9: 78,322,336		noncoding transcript	Het
H2-Eb1	T	A	17: 34,314,368	L188Q	probably damaging	Het
Heatr6	A	G	11: 83,755,773	S95G	probably damaging	Het
Hnf1a	T	A	5: 114,970,574	N91Y	probably damaging	Het
Ints10	C	T	8: 68,827,351	S710F	probably damaging	Het
Kazn	C	T	4: 142,106,904	E614K	unknown	Het
Kif26a	T	A	12: 112,179,916	M1812K	probably benign	Het
Lmo7	A	T	14: 101,902,277	K488*	probably null	Het
Mad1l1	A	G	5: 140,132,816	S457P	probably damaging	Het
Met	A	G	6: 17,533,984	T645A	probably benign	Het
Mpp4	T	C	1: 59,146,744		probably null	Het
Mycl	A	T	4: 122,996,839		probably null	Het
Ncbp1	G	A	4: 46,147,483	R110H	probably damaging	Het
Nfasc	G	T	1: 132,610,305		probably benign	Het
Nup35	A	G	2: 80,655,976	I212V	probably benign	Het
Olfr1181	A	G	2: 88,423,623	M134T	probably damaging	Het
Olfr1373	T	G	11: 52,145,134	Y132S	probably damaging	Het
Ovgp1	A	G	3: 105,986,596		probably benign	Het
Ovgp1	T	C	3: 105,986,567		probably benign	Het
Pcgf5	G	A	19: 36,442,911	S181N	probably damaging	Het
Plk2	C	T	13: 110,399,866	T617I	probably damaging	Het
Polq	A	T	16: 37,092,820		probably null	Het
Ppp1r1a	A	G	15: 103,532,454	L92P	probably damaging	Het
Prg4	G	C	1: 150,454,759		probably benign	Het
Prune1	T	C	3: 95,262,231	K220R	possibly damaging	Het
Rab3gap2	G	A	1: 185,272,643		probably null	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sall3	G	A	18: 80,971,482	A1005V	probably benign	Het
Samd15	T	G	12: 87,200,632	N30K	probably benign	Het
Scn8a	A	T	15: 101,013,413	K905*	probably null	Het
Scrib	G	A	15: 76,051,473	R1245W	possibly damaging	Het
Skint4	C	T	4: 112,124,614	S260L	probably benign	Het
Slc29a2	A	T	19: 5,029,453	M339L	possibly damaging	Het
Synpo2	T	C	3: 123,114,278	D463G	possibly damaging	Het
Taf4	C	A	2: 179,932,012	G688C	probably damaging	Het
Tpte	T	A	8: 22,365,984	V600E	probably damaging	Het
Ttn	A	G	2: 76,821,166	V10953A	probably benign	Het
Vav2	T	C	2: 27,288,679	Y333C	probably benign	Het
Vav2	A	G	2: 27,291,403	S311P	probably damaging	Het
Zbtb26	A	C	2: 37,436,988	M1R	probably null	Het
Zfp26	G	A	9: 20,442,229	P88L	probably benign	Het
Zfp324	T	C	7: 12,970,867	F328L	probably damaging	Het

Other mutations in Spire1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Spire1	APN	18	67529015	missense	probably damaging	1.00
IGL01639:Spire1	APN	18	67545668	missense	possibly damaging	0.74
IGL02334:Spire1	APN	18	67506655	missense	probably benign	0.00
PIT4677001:Spire1	UTSW	18	67491365	missense	probably damaging	1.00
R0457:Spire1	UTSW	18	67552600	missense	probably damaging	0.98
R0531:Spire1	UTSW	18	67491305	missense	probably damaging	1.00
R0608:Spire1	UTSW	18	67528875	missense	probably damaging	0.99
R2098:Spire1	UTSW	18	67503466	missense	probably damaging	0.99
R2299:Spire1	UTSW	18	67530423	missense	probably damaging	1.00
R3028:Spire1	UTSW	18	67491347	missense	probably damaging	1.00
R3815:Spire1	UTSW	18	67506663	missense	probably benign	0.05
R4049:Spire1	UTSW	18	67529031	splice site	probably null
R4059:Spire1	UTSW	18	67545713	missense	probably damaging	0.98
R4109:Spire1	UTSW	18	67497217	missense	probably damaging	1.00
R4700:Spire1	UTSW	18	67512865	missense	probably benign	0.01
R4941:Spire1	UTSW	18	67519314	missense	possibly damaging	0.54
R4995:Spire1	UTSW	18	67552779	unclassified	probably null
R5363:Spire1	UTSW	18	67506555	missense	probably damaging	1.00
R5561:Spire1	UTSW	18	67506646	missense	probably damaging	0.96
R5795:Spire1	UTSW	18	67495195	missense	probably benign
R5952:Spire1	UTSW	18	67506709	missense	probably benign	0.00
R5982:Spire1	UTSW	18	67497316	critical splice acceptor site	probably null
R7388:Spire1	UTSW	18	67519880	missense	probably damaging	1.00
R7559:Spire1	UTSW	18	67501117	missense	probably benign	0.04
T0970:Spire1	UTSW	18	67501063	splice site	probably null
Z1088:Spire1	UTSW	18	67495152	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCCATCTGAGTGCTTACCATTAC -3'
(R):5'- ACTCCCTTCAGTAAGCAGATTC -3'

Sequencing Primer
(F):5'- AGTGCTTACCATTACTTTTCTCAAGG -3'
(R):5'- CTTCAGTAAGCAGATTCTCACAGTAG -3'

Posted On

2015-04-30