Incidental Mutation 'R4050:Spire1'
ID 314138
Institutional Source Beutler Lab
Gene Symbol Spire1
Ensembl Gene ENSMUSG00000024533
Gene Name spire type actin nucleation factor 1
Synonyms 6030430B19Rik, Spir-1
MMRRC Submission 040968-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R4050 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 67488209-67610790 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 67529031 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]
AlphaFold Q52KF3
Predicted Effect probably null
Transcript: ENSMUST00000045105
SMART Domains Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
Pfam:KIND 1 78 3.3e-27 PFAM
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 289 316 N/A INTRINSIC
low complexity region 339 350 N/A INTRINSIC
SCOP:d1zbdb_ 445 518 1e-7 SMART
low complexity region 596 606 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000082243
SMART Domains Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
Blast:KIND 1 73 2e-26 BLAST
PDB:3RBW|D 1 79 3e-28 PDB
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 302 329 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
SCOP:d1zbdb_ 400 473 2e-7 SMART
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115050
SMART Domains Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
PDB:4EFH|B 106 162 9e-6 PDB
low complexity region 219 246 N/A INTRINSIC
low complexity region 269 280 N/A INTRINSIC
SCOP:d1zbdb_ 317 390 4e-7 SMART
low complexity region 468 478 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224799
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,944,992 D473G probably damaging Het
9530053A07Rik T C 7: 28,152,985 V1311A possibly damaging Het
Abca1 T A 4: 53,044,144 Q1826L probably damaging Het
Apob G A 12: 8,015,390 V4087I probably benign Het
Atp10b G A 11: 43,259,536 A1354T probably benign Het
Baz1a A G 12: 54,929,619 V424A probably benign Het
Cdc20b G A 13: 113,064,285 D180N probably benign Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Ddb1 A G 19: 10,627,807 D1053G probably benign Het
Ddx39 T A 8: 83,722,234 M246K probably benign Het
Dip2a G A 10: 76,278,607 T1013M probably damaging Het
Edar G T 10: 58,609,947 T265N possibly damaging Het
Fam207a T C 10: 77,514,330 R75G possibly damaging Het
Fam208b A G 13: 3,573,507 S2148P probably benign Het
Gbp8 T A 5: 105,031,238 I132F probably damaging Het
Gga1 A G 15: 78,891,491 D382G probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm10518 C A 1: 179,803,813 probably benign Het
Gm13078 T C 4: 143,727,122 S267P probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
H2-Eb1 T A 17: 34,314,368 L188Q probably damaging Het
Heatr6 A G 11: 83,755,773 S95G probably damaging Het
Hnf1a T A 5: 114,970,574 N91Y probably damaging Het
Ints10 C T 8: 68,827,351 S710F probably damaging Het
Kazn C T 4: 142,106,904 E614K unknown Het
Kif26a T A 12: 112,179,916 M1812K probably benign Het
Lmo7 A T 14: 101,902,277 K488* probably null Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Met A G 6: 17,533,984 T645A probably benign Het
Mpp4 T C 1: 59,146,744 probably null Het
Mycl A T 4: 122,996,839 probably null Het
Ncbp1 G A 4: 46,147,483 R110H probably damaging Het
Nfasc G T 1: 132,610,305 probably benign Het
Nup35 A G 2: 80,655,976 I212V probably benign Het
Olfr1181 A G 2: 88,423,623 M134T probably damaging Het
Olfr1373 T G 11: 52,145,134 Y132S probably damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcgf5 G A 19: 36,442,911 S181N probably damaging Het
Plk2 C T 13: 110,399,866 T617I probably damaging Het
Polq A T 16: 37,092,820 probably null Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Prune1 T C 3: 95,262,231 K220R possibly damaging Het
Rab3gap2 G A 1: 185,272,643 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall3 G A 18: 80,971,482 A1005V probably benign Het
Samd15 T G 12: 87,200,632 N30K probably benign Het
Scn8a A T 15: 101,013,413 K905* probably null Het
Scrib G A 15: 76,051,473 R1245W possibly damaging Het
Skint4 C T 4: 112,124,614 S260L probably benign Het
Slc29a2 A T 19: 5,029,453 M339L possibly damaging Het
Synpo2 T C 3: 123,114,278 D463G possibly damaging Het
Taf4 C A 2: 179,932,012 G688C probably damaging Het
Tpte T A 8: 22,365,984 V600E probably damaging Het
Ttn A G 2: 76,821,166 V10953A probably benign Het
Vav2 T C 2: 27,288,679 Y333C probably benign Het
Vav2 A G 2: 27,291,403 S311P probably damaging Het
Zbtb26 A C 2: 37,436,988 M1R probably null Het
Zfp26 G A 9: 20,442,229 P88L probably benign Het
Zfp324 T C 7: 12,970,867 F328L probably damaging Het
Other mutations in Spire1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Spire1 APN 18 67529015 missense probably damaging 1.00
IGL01639:Spire1 APN 18 67545668 missense possibly damaging 0.74
IGL02334:Spire1 APN 18 67506655 missense probably benign 0.00
PIT4677001:Spire1 UTSW 18 67491365 missense probably damaging 1.00
R0457:Spire1 UTSW 18 67552600 missense probably damaging 0.98
R0531:Spire1 UTSW 18 67491305 missense probably damaging 1.00
R0608:Spire1 UTSW 18 67528875 missense probably damaging 0.99
R2098:Spire1 UTSW 18 67503466 missense probably damaging 0.99
R2299:Spire1 UTSW 18 67530423 missense probably damaging 1.00
R3028:Spire1 UTSW 18 67491347 missense probably damaging 1.00
R3815:Spire1 UTSW 18 67506663 missense probably benign 0.05
R4049:Spire1 UTSW 18 67529031 splice site probably null
R4059:Spire1 UTSW 18 67545713 missense probably damaging 0.98
R4109:Spire1 UTSW 18 67497217 missense probably damaging 1.00
R4700:Spire1 UTSW 18 67512865 missense probably benign 0.01
R4941:Spire1 UTSW 18 67519314 missense possibly damaging 0.54
R4995:Spire1 UTSW 18 67552779 splice site probably null
R5363:Spire1 UTSW 18 67506555 missense probably damaging 1.00
R5561:Spire1 UTSW 18 67506646 missense probably damaging 0.96
R5795:Spire1 UTSW 18 67495195 missense probably benign
R5952:Spire1 UTSW 18 67506709 missense probably benign 0.00
R5982:Spire1 UTSW 18 67497316 critical splice acceptor site probably null
R7388:Spire1 UTSW 18 67519880 missense probably damaging 1.00
R7559:Spire1 UTSW 18 67501117 missense probably benign 0.04
R8006:Spire1 UTSW 18 67501181 nonsense probably null
R8111:Spire1 UTSW 18 67519321 missense probably damaging 0.98
R8675:Spire1 UTSW 18 67491308 missense possibly damaging 0.48
R8946:Spire1 UTSW 18 67496616 missense probably damaging 1.00
R9441:Spire1 UTSW 18 67519392 missense probably benign 0.41
T0970:Spire1 UTSW 18 67501063 splice site probably null
Z1088:Spire1 UTSW 18 67495152 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCCATCTGAGTGCTTACCATTAC -3'
(R):5'- ACTCCCTTCAGTAAGCAGATTC -3'

Sequencing Primer
(F):5'- AGTGCTTACCATTACTTTTCTCAAGG -3'
(R):5'- CTTCAGTAAGCAGATTCTCACAGTAG -3'
Posted On 2015-04-30