Incidental Mutation 'R4051:Zfp217'
ID314147
Institutional Source Beutler Lab
Gene Symbol Zfp217
Ensembl Gene ENSMUSG00000052056
Gene Namezinc finger protein 217
Synonyms4933431C08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R4051 ()
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location170108643-170148103 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 170112616 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063710] [ENSMUST00000109155]
Predicted Effect probably null
Transcript: ENSMUST00000063710
SMART Domains Protein: ENSMUSP00000067334
Gene: ENSMUSG00000052056

DomainStartEndE-ValueType
ZnF_C2H2 57 80 1.64e-1 SMART
ZnF_C2H2 121 143 9.58e-3 SMART
ZnF_C2H2 149 171 1.47e-3 SMART
ZnF_C2H2 208 230 2.91e-2 SMART
low complexity region 333 348 N/A INTRINSIC
ZnF_C2H2 383 405 1.53e-1 SMART
low complexity region 437 455 N/A INTRINSIC
ZnF_C2H2 478 500 1.36e-2 SMART
ZnF_C2H2 506 528 9.58e-3 SMART
ZnF_C2H2 704 727 2.29e0 SMART
low complexity region 854 874 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109155
SMART Domains Protein: ENSMUSP00000104783
Gene: ENSMUSG00000052056

DomainStartEndE-ValueType
ZnF_C2H2 57 80 1.64e-1 SMART
ZnF_C2H2 121 143 9.58e-3 SMART
ZnF_C2H2 149 171 1.47e-3 SMART
ZnF_C2H2 208 230 2.91e-2 SMART
low complexity region 333 348 N/A INTRINSIC
ZnF_C2H2 383 405 1.53e-1 SMART
low complexity region 437 455 N/A INTRINSIC
ZnF_C2H2 478 500 1.36e-2 SMART
ZnF_C2H2 506 528 9.58e-3 SMART
ZnF_C2H2 704 727 2.29e0 SMART
low complexity region 854 874 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ahnak A C 19: 9,014,327 D4325A probably damaging Het
Chtf18 A G 17: 25,719,194 V955A probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Disc1 A G 8: 125,148,425 T547A possibly damaging Het
Eif4b A G 15: 102,086,604 Y211C probably benign Het
Fli1 T G 9: 32,452,162 D176A probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Ice1 A G 13: 70,603,527 V1480A probably damaging Het
Ier5l A C 2: 30,473,312 S234A probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Itga11 C T 9: 62,755,651 Q550* probably null Het
Kdr T A 5: 75,968,408 M193L probably benign Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Olfr554 T C 7: 102,641,026 V260A possibly damaging Het
Peg10 T C 6: 4,754,534 L105P probably benign Het
Phtf1 A G 3: 104,005,508 T717A possibly damaging Het
Ptafr T C 4: 132,579,994 W232R probably benign Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Slamf7 T C 1: 171,637,383 K261E possibly damaging Het
Slc9c1 T A 16: 45,543,230 Y120N probably damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tbc1d9b T C 11: 50,171,243 C1210R probably benign Het
Tnfsf10 T A 3: 27,335,354 I188N probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Usp46 T C 5: 74,002,755 N283S probably benign Het
Vmn2r84 T G 10: 130,390,898 N357T probably damaging Het
Other mutations in Zfp217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Zfp217 APN 2 170115149 missense probably benign
IGL02412:Zfp217 APN 2 170112502 utr 3 prime probably benign
IGL02435:Zfp217 APN 2 170119453 missense possibly damaging 0.56
IGL03152:Zfp217 APN 2 170119052 missense probably damaging 1.00
PIT4581001:Zfp217 UTSW 2 170114583 missense probably benign 0.01
R0107:Zfp217 UTSW 2 170114874 nonsense probably null
R0109:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0109:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0110:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0180:Zfp217 UTSW 2 170120137 missense probably damaging 1.00
R0200:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0279:Zfp217 UTSW 2 170119780 missense probably benign 0.28
R0395:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0396:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0453:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0510:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0512:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0513:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0653:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R1549:Zfp217 UTSW 2 170114470 missense probably benign 0.00
R3420:Zfp217 UTSW 2 170120017 missense possibly damaging 0.90
R3421:Zfp217 UTSW 2 170120017 missense possibly damaging 0.90
R3422:Zfp217 UTSW 2 170120017 missense possibly damaging 0.90
R3726:Zfp217 UTSW 2 170119210 missense probably damaging 0.96
R3731:Zfp217 UTSW 2 170114388 missense probably benign 0.31
R3926:Zfp217 UTSW 2 170112518 missense probably damaging 1.00
R4289:Zfp217 UTSW 2 170114787 missense probably benign 0.01
R4606:Zfp217 UTSW 2 170119750 missense possibly damaging 0.67
R4948:Zfp217 UTSW 2 170119210 missense probably damaging 0.96
R5113:Zfp217 UTSW 2 170114058 splice site probably null
R5734:Zfp217 UTSW 2 170119144 missense possibly damaging 0.57
R6228:Zfp217 UTSW 2 170119577 missense probably benign 0.01
R6452:Zfp217 UTSW 2 170119294 missense probably benign
R6782:Zfp217 UTSW 2 170116258 missense probably damaging 1.00
R7212:Zfp217 UTSW 2 170114152 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GAACAGCACTGTCCGTGTAC -3'
(R):5'- TCACTTTAAGTATGTGAGTGCCAAG -3'

Sequencing Primer
(F):5'- GTGTACCCACCCACACTGAG -3'
(R):5'- CTGGGTTTAAGGGCAAATATCACC -3'
Posted On2015-04-30