Incidental Mutation 'R4051:Steap4'
ID314152
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene NameSTEAP family member 4
SynonymsTiarp, Tnfaip9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4051 ()
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location7960457-7982213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7980404 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 420 (Y420C)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
Predicted Effect probably damaging
Transcript: ENSMUST00000115421
AA Change: Y420C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: Y420C

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Meta Mutation Damage Score 0.2041 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ahnak A C 19: 9,014,327 D4325A probably damaging Het
Chtf18 A G 17: 25,719,194 V955A probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Disc1 A G 8: 125,148,425 T547A possibly damaging Het
Eif4b A G 15: 102,086,604 Y211C probably benign Het
Fli1 T G 9: 32,452,162 D176A probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Ice1 A G 13: 70,603,527 V1480A probably damaging Het
Ier5l A C 2: 30,473,312 S234A probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Itga11 C T 9: 62,755,651 Q550* probably null Het
Kdr T A 5: 75,968,408 M193L probably benign Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Olfr554 T C 7: 102,641,026 V260A possibly damaging Het
Peg10 T C 6: 4,754,534 L105P probably benign Het
Phtf1 A G 3: 104,005,508 T717A possibly damaging Het
Ptafr T C 4: 132,579,994 W232R probably benign Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Slamf7 T C 1: 171,637,383 K261E possibly damaging Het
Slc9c1 T A 16: 45,543,230 Y120N probably damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Tbc1d9b T C 11: 50,171,243 C1210R probably benign Het
Tnfsf10 T A 3: 27,335,354 I188N probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Usp46 T C 5: 74,002,755 N283S probably benign Het
Vmn2r84 T G 10: 130,390,898 N357T probably damaging Het
Zfp217 T C 2: 170,112,616 probably null Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 7976979 missense probably damaging 1.00
IGL00827:Steap4 APN 5 7976712 missense probably damaging 1.00
IGL01481:Steap4 APN 5 7976858 missense probably damaging 0.98
IGL02378:Steap4 APN 5 7976741 missense probably benign 0.00
IGL03058:Steap4 APN 5 7975664 missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 7980337 missense probably benign 0.03
R0329:Steap4 UTSW 5 7975829 missense possibly damaging 0.92
R0546:Steap4 UTSW 5 7975870 missense probably damaging 0.99
R0637:Steap4 UTSW 5 7978398 splice site probably benign
R0638:Steap4 UTSW 5 7977030 splice site probably benign
R0651:Steap4 UTSW 5 7980348 nonsense probably null
R0881:Steap4 UTSW 5 7980388 missense probably benign
R1167:Steap4 UTSW 5 7976520 missense probably benign 0.34
R1543:Steap4 UTSW 5 7975902 splice site probably benign
R1889:Steap4 UTSW 5 7975892 missense probably damaging 1.00
R3803:Steap4 UTSW 5 7976979 missense probably damaging 1.00
R3811:Steap4 UTSW 5 7977017 missense probably benign 0.18
R3885:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R3887:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R4208:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R5016:Steap4 UTSW 5 7976699 nonsense probably null
R5302:Steap4 UTSW 5 7975547 nonsense probably null
R5951:Steap4 UTSW 5 7975769 missense probably benign 0.00
R6136:Steap4 UTSW 5 7978562 missense probably damaging 0.99
R6527:Steap4 UTSW 5 7978502 missense probably damaging 0.99
R6631:Steap4 UTSW 5 7976995 nonsense probably null
R6964:Steap4 UTSW 5 7975568 missense probably damaging 1.00
R7055:Steap4 UTSW 5 7976858 missense probably damaging 1.00
R7408:Steap4 UTSW 5 7978453 missense probably benign 0.07
R7692:Steap4 UTSW 5 7976976 missense probably benign 0.32
R8205:Steap4 UTSW 5 7976795 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CAAGTACGTTTCATTGGCATGC -3'
(R):5'- GCCATGACAAGAGAAAATGCTTTC -3'

Sequencing Primer
(F):5'- TCATTGGCATGCAGTATTTCAC -3'
(R):5'- TACTGCAATAGTACACAAATCCTGG -3'
Posted On2015-04-30