Incidental Mutation 'R4051:Ino80b'
ID314157
Institutional Source Beutler Lab
Gene Symbol Ino80b
Ensembl Gene ENSMUSG00000030034
Gene NameINO80 complex subunit B
SynonymsPapa1, Znhit4, 2510009I23Rik, HMG1YL4, Hmga1l4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4051 ()
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83121765-83125431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 83122333 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 178 (P178R)
Ref Sequence ENSEMBL: ENSMUSP00000032109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032109] [ENSMUST00000032111] [ENSMUST00000032114] [ENSMUST00000113935] [ENSMUST00000113936] [ENSMUST00000143814] [ENSMUST00000146328] [ENSMUST00000151393] [ENSMUST00000205023]
Predicted Effect probably damaging
Transcript: ENSMUST00000032109
AA Change: P178R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032109
Gene: ENSMUSG00000030034
AA Change: P178R

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 129 137 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
Pfam:PAPA-1 198 282 1.6e-27 PFAM
Pfam:zf-HIT 294 325 6.1e-10 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032111
SMART Domains Protein: ENSMUSP00000032111
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 177 1.4e-50 PFAM
low complexity region 185 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032114
SMART Domains Protein: ENSMUSP00000032114
Gene: ENSMUSG00000030036

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
Pfam:Glyco_hydro_63N 91 267 1.1e-54 PFAM
Pfam:Glyco_hydro_63 349 832 7e-202 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113935
AA Change: P208R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109568
Gene: ENSMUSG00000030034
AA Change: P208R

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
Pfam:PAPA-1 228 309 4e-23 PFAM
Pfam:zf-HIT 324 355 4.3e-11 PFAM
low complexity region 360 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113936
SMART Domains Protein: ENSMUSP00000109569
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:WBP-1 36 142 1.2e-50 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123394
Predicted Effect probably benign
Transcript: ENSMUST00000131936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142493
Predicted Effect probably benign
Transcript: ENSMUST00000143814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145403
Predicted Effect probably benign
Transcript: ENSMUST00000146328
SMART Domains Protein: ENSMUSP00000122900
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:WBP-1 70 176 1.8e-50 PFAM
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151393
SMART Domains Protein: ENSMUSP00000145130
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 96 4.4e-6 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203085
Predicted Effect probably benign
Transcript: ENSMUST00000205023
Meta Mutation Damage Score 0.1582 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an ATP-dependent chromatin remodeling complex, INO80, which plays a role in DNA and nucleosome-activated ATPase activity and ATP-dependent nucleosome sliding. Readthrough transcription of this gene into the neighboring downstream gene, which encodes WW domain-binding protein 1, generates a non-coding transcript. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ahnak A C 19: 9,014,327 D4325A probably damaging Het
Chtf18 A G 17: 25,719,194 V955A probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Disc1 A G 8: 125,148,425 T547A possibly damaging Het
Eif4b A G 15: 102,086,604 Y211C probably benign Het
Fli1 T G 9: 32,452,162 D176A probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Ice1 A G 13: 70,603,527 V1480A probably damaging Het
Ier5l A C 2: 30,473,312 S234A probably benign Het
Itga11 C T 9: 62,755,651 Q550* probably null Het
Kdr T A 5: 75,968,408 M193L probably benign Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Olfr554 T C 7: 102,641,026 V260A possibly damaging Het
Peg10 T C 6: 4,754,534 L105P probably benign Het
Phtf1 A G 3: 104,005,508 T717A possibly damaging Het
Ptafr T C 4: 132,579,994 W232R probably benign Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Slamf7 T C 1: 171,637,383 K261E possibly damaging Het
Slc9c1 T A 16: 45,543,230 Y120N probably damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tbc1d9b T C 11: 50,171,243 C1210R probably benign Het
Tnfsf10 T A 3: 27,335,354 I188N probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Usp46 T C 5: 74,002,755 N283S probably benign Het
Vmn2r84 T G 10: 130,390,898 N357T probably damaging Het
Zfp217 T C 2: 170,112,616 probably null Het
Other mutations in Ino80b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Ino80b APN 6 83124148 missense probably damaging 1.00
IGL02063:Ino80b APN 6 83124162 missense probably damaging 0.99
R0310:Ino80b UTSW 6 83124091 missense probably damaging 1.00
R2022:Ino80b UTSW 6 83124372 missense probably damaging 0.98
R4052:Ino80b UTSW 6 83122333 missense probably damaging 1.00
R4114:Ino80b UTSW 6 83124140 missense probably benign 0.00
R4207:Ino80b UTSW 6 83122333 missense probably damaging 1.00
R4208:Ino80b UTSW 6 83122333 missense probably damaging 1.00
R4751:Ino80b UTSW 6 83124750 missense probably damaging 0.99
R5023:Ino80b UTSW 6 83125042 missense probably damaging 1.00
R6111:Ino80b UTSW 6 83124366 missense probably damaging 1.00
R6298:Ino80b UTSW 6 83125085 missense possibly damaging 0.92
R6467:Ino80b UTSW 6 83124131 unclassified probably null
R7024:Ino80b UTSW 6 83122325 missense probably benign 0.03
X0023:Ino80b UTSW 6 83121952 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCACTGTAGGCTGCAAAGG -3'
(R):5'- GAAGTGTGGTATTAAGGGTCCC -3'

Sequencing Primer
(F):5'- TGCAGTAGCGCACCATG -3'
(R):5'- GTGGCACAAGCATTTGATCC -3'
Posted On2015-04-30