Incidental Mutation 'R4051:Disc1'
ID314164
Institutional Source Beutler Lab
Gene Symbol Disc1
Ensembl Gene ENSMUSG00000043051
Gene Namedisrupted in schizophrenia 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R4051 ()
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125054195-125261858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125148425 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 547 (T547A)
Ref Sequence ENSEMBL: ENSMUSP00000111552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074562] [ENSMUST00000075730] [ENSMUST00000098311] [ENSMUST00000115885] [ENSMUST00000117658] [ENSMUST00000118942] [ENSMUST00000121953]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074562
AA Change: T547A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074147
Gene: ENSMUSG00000043051
AA Change: T547A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075730
AA Change: T547A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075145
Gene: ENSMUSG00000043051
AA Change: T547A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098311
AA Change: T547A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095914
Gene: ENSMUSG00000043051
AA Change: T547A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115885
AA Change: T547A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111552
Gene: ENSMUSG00000043051
AA Change: T547A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117658
AA Change: T547A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112757
Gene: ENSMUSG00000043051
AA Change: T547A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118942
AA Change: T547A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112410
Gene: ENSMUSG00000043051
AA Change: T547A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121953
AA Change: T545A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112929
Gene: ENSMUSG00000043051
AA Change: T545A

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
low complexity region 286 322 N/A INTRINSIC
coiled coil region 370 395 N/A INTRINSIC
coiled coil region 447 494 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show altered anxiety, synaptic depression, LTP, impulsivity, social investigation, hyperactivity and prepulse inhibition. Homozygotes for a spontaneous allele show altered working memory. Different ENU mutations cause distinct depression and schizophrenia-like profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ahnak A C 19: 9,014,327 D4325A probably damaging Het
Chtf18 A G 17: 25,719,194 V955A probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Eif4b A G 15: 102,086,604 Y211C probably benign Het
Fli1 T G 9: 32,452,162 D176A probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Ice1 A G 13: 70,603,527 V1480A probably damaging Het
Ier5l A C 2: 30,473,312 S234A probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Itga11 C T 9: 62,755,651 Q550* probably null Het
Kdr T A 5: 75,968,408 M193L probably benign Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Olfr554 T C 7: 102,641,026 V260A possibly damaging Het
Peg10 T C 6: 4,754,534 L105P probably benign Het
Phtf1 A G 3: 104,005,508 T717A possibly damaging Het
Ptafr T C 4: 132,579,994 W232R probably benign Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Slamf7 T C 1: 171,637,383 K261E possibly damaging Het
Slc9c1 T A 16: 45,543,230 Y120N probably damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tbc1d9b T C 11: 50,171,243 C1210R probably benign Het
Tnfsf10 T A 3: 27,335,354 I188N probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Usp46 T C 5: 74,002,755 N283S probably benign Het
Vmn2r84 T G 10: 130,390,898 N357T probably damaging Het
Zfp217 T C 2: 170,112,616 probably null Het
Other mutations in Disc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Disc1 APN 8 125088275 missense probably benign 0.27
IGL01319:Disc1 APN 8 125087891 missense probably damaging 0.99
IGL02001:Disc1 APN 8 125251042 missense probably damaging 0.97
IGL02403:Disc1 APN 8 125135519 splice site probably benign
IGL02445:Disc1 APN 8 125148403 splice site probably benign
R0334:Disc1 UTSW 8 125261097 synonymous probably null
R0992:Disc1 UTSW 8 125088042 missense probably damaging 1.00
R1654:Disc1 UTSW 8 125148465 missense possibly damaging 0.90
R1711:Disc1 UTSW 8 125124610 missense probably benign 0.05
R3154:Disc1 UTSW 8 125135304 missense probably damaging 1.00
R3947:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3948:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R3949:Disc1 UTSW 8 125088135 missense probably damaging 1.00
R4199:Disc1 UTSW 8 125148459 missense probably damaging 1.00
R4691:Disc1 UTSW 8 125148447 missense possibly damaging 0.90
R4763:Disc1 UTSW 8 125124538 missense probably damaging 1.00
R4825:Disc1 UTSW 8 125135302 missense possibly damaging 0.86
R4969:Disc1 UTSW 8 125124550 nonsense probably null
R5087:Disc1 UTSW 8 125132160 missense probably benign
R5383:Disc1 UTSW 8 125135457 missense probably damaging 1.00
R5827:Disc1 UTSW 8 125135365 missense probably damaging 1.00
R5828:Disc1 UTSW 8 125251024 missense probably damaging 0.99
R6431:Disc1 UTSW 8 125135389 missense possibly damaging 0.87
R6501:Disc1 UTSW 8 125218105 missense probably benign 0.00
R6794:Disc1 UTSW 8 125087775 missense probably benign 0.37
R7058:Disc1 UTSW 8 125250985 missense probably damaging 1.00
R7350:Disc1 UTSW 8 125165102 missense probably damaging 1.00
R7365:Disc1 UTSW 8 125155041 missense probably damaging 1.00
R7732:Disc1 UTSW 8 125250975 nonsense probably null
R7757:Disc1 UTSW 8 125087504 missense probably benign 0.03
R8113:Disc1 UTSW 8 125088275 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GTGAAGACAGATTTTAATGGTGGAC -3'
(R):5'- AGACATCCTCAGAGTCTGCG -3'

Sequencing Primer
(F):5'- GGGTTACTTCCATGGTCATGTCAAC -3'
(R):5'- TGCGGCTCCAGTCTTCAG -3'
Posted On2015-04-30