Incidental Mutation 'R4051:Hcn2'
ID314170
Institutional Source Beutler Lab
Gene Symbol Hcn2
Ensembl Gene ENSMUSG00000020331
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 2
SynonymsHAC1, trls
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4051 ()
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79716634-79736108 bp(+) (GRCm38)
Type of Mutationunclassified (2440 bp from exon)
DNA Base Change (assembly) A to C at 79733687 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020580] [ENSMUST00000020581] [ENSMUST00000099513] [ENSMUST00000159016] [ENSMUST00000162694]
Predicted Effect probably null
Transcript: ENSMUST00000020580
SMART Domains Protein: ENSMUSP00000020580
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 802 1207 5.6e-169 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000020581
AA Change: N507T

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020581
Gene: ENSMUSG00000020331
AA Change: N507T

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 140 183 5e-23 PFAM
Pfam:Ion_trans 184 447 3.3e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099513
AA Change: N507T

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097113
Gene: ENSMUSG00000020331
AA Change: N507T

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 139 215 2.6e-47 PFAM
Pfam:Ion_trans 219 435 1.5e-20 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159016
SMART Domains Protein: ENSMUSP00000124936
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 601 6.27e-50 SMART
low complexity region 629 640 N/A INTRINSIC
Pfam:RNA_pol 727 1133 7.5e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161098
Predicted Effect probably null
Transcript: ENSMUST00000161662
SMART Domains Protein: ENSMUSP00000124230
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
Pfam:RNA_pol 29 120 6.7e-39 PFAM
Pfam:RNA_pol 119 393 2.7e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162687
Predicted Effect probably benign
Transcript: ENSMUST00000162694
SMART Domains Protein: ENSMUSP00000124556
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 801 895 6.4e-34 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a hyperpolarization-activated cation channel involved in the generation of native pacemaker activity in the heart and in the brain. The encoded protein is activated by cAMP and can produce a fast, large current. Defects in this gene were noted as a possible cause of some forms of epilepsy. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for mutant alleles exhibit decreased body weight, behavioral/neurological abnormalities, and tremors or absence seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ahnak A C 19: 9,014,327 D4325A probably damaging Het
Chtf18 A G 17: 25,719,194 V955A probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Disc1 A G 8: 125,148,425 T547A possibly damaging Het
Eif4b A G 15: 102,086,604 Y211C probably benign Het
Fli1 T G 9: 32,452,162 D176A probably benign Het
Ice1 A G 13: 70,603,527 V1480A probably damaging Het
Ier5l A C 2: 30,473,312 S234A probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Itga11 C T 9: 62,755,651 Q550* probably null Het
Kdr T A 5: 75,968,408 M193L probably benign Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Olfr554 T C 7: 102,641,026 V260A possibly damaging Het
Peg10 T C 6: 4,754,534 L105P probably benign Het
Phtf1 A G 3: 104,005,508 T717A possibly damaging Het
Ptafr T C 4: 132,579,994 W232R probably benign Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Slamf7 T C 1: 171,637,383 K261E possibly damaging Het
Slc9c1 T A 16: 45,543,230 Y120N probably damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tbc1d9b T C 11: 50,171,243 C1210R probably benign Het
Tnfsf10 T A 3: 27,335,354 I188N probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Usp46 T C 5: 74,002,755 N283S probably benign Het
Vmn2r84 T G 10: 130,390,898 N357T probably damaging Het
Zfp217 T C 2: 170,112,616 probably null Het
Other mutations in Hcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Hcn2 APN 10 79733803 nonsense probably null
IGL01339:Hcn2 APN 10 79729068 missense probably damaging 1.00
IGL02183:Hcn2 APN 10 79724813 critical splice donor site probably null
asombrarse UTSW 10 79724611 missense probably damaging 1.00
curveball UTSW 10 79724786 missense probably damaging 1.00
curveball2 UTSW 10 79733773 nonsense probably null
mire UTSW 10 79729113 critical splice donor site probably null
R0269:Hcn2 UTSW 10 79734241 unclassified probably benign
R0671:Hcn2 UTSW 10 79734232 splice site probably null
R1879:Hcn2 UTSW 10 79726189 missense probably benign 0.03
R1913:Hcn2 UTSW 10 79730943 missense probably benign 0.14
R4052:Hcn2 UTSW 10 79733687 unclassified probably null
R4328:Hcn2 UTSW 10 79724611 missense probably damaging 1.00
R4507:Hcn2 UTSW 10 79724786 missense probably damaging 1.00
R4518:Hcn2 UTSW 10 79724702 missense probably benign 0.17
R4578:Hcn2 UTSW 10 79724448 synonymous probably null
R5334:Hcn2 UTSW 10 79726291 missense probably damaging 0.99
R5788:Hcn2 UTSW 10 79717111 missense possibly damaging 0.48
R6131:Hcn2 UTSW 10 79733908 missense probably damaging 1.00
R6457:Hcn2 UTSW 10 79733773 nonsense probably null
R6547:Hcn2 UTSW 10 79717152 missense probably benign 0.29
R6851:Hcn2 UTSW 10 79729113 critical splice donor site probably null
R7276:Hcn2 UTSW 10 79729100 missense possibly damaging 0.95
R7706:Hcn2 UTSW 10 79734183 missense possibly damaging 0.78
R7893:Hcn2 UTSW 10 79724411 missense probably damaging 1.00
R7976:Hcn2 UTSW 10 79724411 missense probably damaging 1.00
X0024:Hcn2 UTSW 10 79734120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATGGTGGTATGGGGACTACAG -3'
(R):5'- AGCCATCCGACAGCTTCATC -3'

Sequencing Primer
(F):5'- GGGGACTACAGACTTTCCTGTATAC -3'
(R):5'- TTGCCCTTGGTGAGCAC -3'
Posted On2015-04-30