Incidental Mutation 'R4051:Rnase4'
ID314176
Institutional Source Beutler Lab
Gene Symbol Rnase4
Ensembl Gene ENSMUSG00000021876
Gene Nameribonuclease, RNase A family 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4051 ()
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51091077-51106151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51105005 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 62 (K62R)
Ref Sequence ENSEMBL: ENSMUSP00000127274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022428] [ENSMUST00000069011] [ENSMUST00000169895] [ENSMUST00000171688]
Predicted Effect probably benign
Transcript: ENSMUST00000022428
AA Change: K62R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022428
Gene: ENSMUSG00000021876
AA Change: K62R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
RNAse_Pc 30 148 8.54e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069011
SMART Domains Protein: ENSMUSP00000067434
Gene: ENSMUSG00000072115

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
RNAse_Pc 26 142 6.52e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169895
AA Change: K62R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127274
Gene: ENSMUSG00000021876
AA Change: K62R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
RNAse_Pc 30 148 8.54e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171688
SMART Domains Protein: ENSMUSP00000132084
Gene: ENSMUSG00000072115

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
RNAse_Pc 26 142 6.52e-65 SMART
Meta Mutation Damage Score 0.0687 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the pancreatic ribonuclease A superfamily. The encoded enzyme is sereted and has unique uridine specificity. This gene resides in a cluster of highly related genes. It shares dual promoters and 5' exons with the angiogenin, ribonuclease, RNase A family, 5 gene. Each gene splices to a unique downstream exon that contains its complete coding region. Two alternatively spliced variants, with different 5' exons but the same coding exon, have been identified. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ahnak A C 19: 9,014,327 D4325A probably damaging Het
Chtf18 A G 17: 25,719,194 V955A probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Disc1 A G 8: 125,148,425 T547A possibly damaging Het
Eif4b A G 15: 102,086,604 Y211C probably benign Het
Fli1 T G 9: 32,452,162 D176A probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Ice1 A G 13: 70,603,527 V1480A probably damaging Het
Ier5l A C 2: 30,473,312 S234A probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Itga11 C T 9: 62,755,651 Q550* probably null Het
Kdr T A 5: 75,968,408 M193L probably benign Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Olfr554 T C 7: 102,641,026 V260A possibly damaging Het
Peg10 T C 6: 4,754,534 L105P probably benign Het
Phtf1 A G 3: 104,005,508 T717A possibly damaging Het
Ptafr T C 4: 132,579,994 W232R probably benign Het
Slamf7 T C 1: 171,637,383 K261E possibly damaging Het
Slc9c1 T A 16: 45,543,230 Y120N probably damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tbc1d9b T C 11: 50,171,243 C1210R probably benign Het
Tnfsf10 T A 3: 27,335,354 I188N probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Usp46 T C 5: 74,002,755 N283S probably benign Het
Vmn2r84 T G 10: 130,390,898 N357T probably damaging Het
Zfp217 T C 2: 170,112,616 probably null Het
Other mutations in Rnase4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Rnase4 APN 14 51104921 missense probably damaging 1.00
R0601:Rnase4 UTSW 14 51105095 missense probably benign
R0671:Rnase4 UTSW 14 51105050 missense probably damaging 1.00
R0948:Rnase4 UTSW 14 51104905 missense probably damaging 1.00
R1571:Rnase4 UTSW 14 51105040 missense probably damaging 1.00
R1758:Rnase4 UTSW 14 51105265 makesense probably null
R1893:Rnase4 UTSW 14 51104938 missense possibly damaging 0.92
R4052:Rnase4 UTSW 14 51105005 missense probably benign
R4207:Rnase4 UTSW 14 51105005 missense probably benign
R4208:Rnase4 UTSW 14 51105005 missense probably benign
R5074:Rnase4 UTSW 14 51105245 missense possibly damaging 0.88
R5739:Rnase4 UTSW 14 51104849 missense probably benign 0.01
R6742:Rnase4 UTSW 14 51105029 missense probably benign 0.12
R7878:Rnase4 UTSW 14 51104876 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATGGATCTACAGAGGACTCAGTC -3'
(R):5'- CAATGACAACTCGCCTAGTGC -3'

Sequencing Primer
(F):5'- AGTCCTTGCTTCTGCTCTTGGTG -3'
(R):5'- ACAACTCGCCTAGTGCTGGTTC -3'
Posted On2015-04-30