Incidental Mutation 'R4051:Chtf18'
ID314179
Institutional Source Beutler Lab
Gene Symbol Chtf18
Ensembl Gene ENSMUSG00000019214
Gene NameCTF18, chromosome transmission fidelity factor 18
Synonyms6030457M03Rik, CTF18
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R4051 ()
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25718926-25727419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25719194 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 955 (V955A)
Ref Sequence ENSEMBL: ENSMUSP00000043896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048054] [ENSMUST00000115108] [ENSMUST00000167940] [ENSMUST00000170575] [ENSMUST00000172002]
Predicted Effect probably damaging
Transcript: ENSMUST00000048054
AA Change: V955A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043896
Gene: ENSMUSG00000019214
AA Change: V955A

DomainStartEndE-ValueType
low complexity region 20 30 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 228 255 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
AAA 361 518 1.99e-11 SMART
low complexity region 646 661 N/A INTRINSIC
Blast:AAA 728 850 7e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115108
SMART Domains Protein: ENSMUSP00000110760
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167940
SMART Domains Protein: ENSMUSP00000131349
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Blast:AAA 21 107 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168914
Predicted Effect unknown
Transcript: ENSMUST00000169767
AA Change: V94A
Predicted Effect probably benign
Transcript: ENSMUST00000170575
SMART Domains Protein: ENSMUSP00000131366
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172002
SMART Domains Protein: ENSMUSP00000131648
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a component of a replication factor C (RFC) complex, which loads proliferating cell nuclear antigen (PCNA) on to DNA during the S phase of cell cycle. The encoded protein may interact with other proteins, including RFC complex 3, to form a clamp loader complex that plays a role in sister chromatid cohesion during metaphase-anaphase transition. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, reduced body and testis weight, defective male meiosis, impaired spermatogenesis, oligozoospermia, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ahnak A C 19: 9,014,327 D4325A probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Disc1 A G 8: 125,148,425 T547A possibly damaging Het
Eif4b A G 15: 102,086,604 Y211C probably benign Het
Fli1 T G 9: 32,452,162 D176A probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Ice1 A G 13: 70,603,527 V1480A probably damaging Het
Ier5l A C 2: 30,473,312 S234A probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Itga11 C T 9: 62,755,651 Q550* probably null Het
Kdr T A 5: 75,968,408 M193L probably benign Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Olfr554 T C 7: 102,641,026 V260A possibly damaging Het
Peg10 T C 6: 4,754,534 L105P probably benign Het
Phtf1 A G 3: 104,005,508 T717A possibly damaging Het
Ptafr T C 4: 132,579,994 W232R probably benign Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Slamf7 T C 1: 171,637,383 K261E possibly damaging Het
Slc9c1 T A 16: 45,543,230 Y120N probably damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tbc1d9b T C 11: 50,171,243 C1210R probably benign Het
Tnfsf10 T A 3: 27,335,354 I188N probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Usp46 T C 5: 74,002,755 N283S probably benign Het
Vmn2r84 T G 10: 130,390,898 N357T probably damaging Het
Zfp217 T C 2: 170,112,616 probably null Het
Other mutations in Chtf18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Chtf18 APN 17 25722116 missense probably benign 0.32
IGL02117:Chtf18 APN 17 25722203 missense possibly damaging 0.63
IGL03034:Chtf18 APN 17 25727346 utr 5 prime probably benign
IGL03051:Chtf18 APN 17 25720964 missense probably damaging 1.00
IGL03164:Chtf18 APN 17 25726842 missense probably benign 0.24
R0046:Chtf18 UTSW 17 25723460 missense probably benign 0.06
R0129:Chtf18 UTSW 17 25727311 nonsense probably null
R1122:Chtf18 UTSW 17 25724623 missense probably damaging 1.00
R1302:Chtf18 UTSW 17 25719158 missense probably damaging 1.00
R1487:Chtf18 UTSW 17 25720609 missense probably benign 0.00
R1614:Chtf18 UTSW 17 25727090 missense probably benign 0.00
R1820:Chtf18 UTSW 17 25725939 missense probably damaging 1.00
R4357:Chtf18 UTSW 17 25719132 missense probably benign 0.09
R4529:Chtf18 UTSW 17 25720618 missense probably damaging 1.00
R4804:Chtf18 UTSW 17 25719257 missense probably benign
R4975:Chtf18 UTSW 17 25724566 missense possibly damaging 0.72
R5154:Chtf18 UTSW 17 25723720 missense probably damaging 1.00
R6113:Chtf18 UTSW 17 25722867 missense probably damaging 1.00
R6118:Chtf18 UTSW 17 25719159 missense probably damaging 1.00
R6446:Chtf18 UTSW 17 25721244 missense probably benign 0.01
R7057:Chtf18 UTSW 17 25721126 missense possibly damaging 0.49
R7095:Chtf18 UTSW 17 25722678 missense probably damaging 1.00
R7482:Chtf18 UTSW 17 25719989 missense possibly damaging 0.48
R7641:Chtf18 UTSW 17 25722275 intron probably null
R7729:Chtf18 UTSW 17 25723517 missense probably damaging 1.00
R8007:Chtf18 UTSW 17 25725534 missense probably damaging 0.96
R8051:Chtf18 UTSW 17 25723479 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAGAGAAGGCCAAGTGCACC -3'
(R):5'- CGTGTGGTCATCAGGAAAGTGG -3'

Sequencing Primer
(F):5'- AGTGCACCATCCTATGAGCCTG -3'
(R):5'- TCATCAGGAAAGTGGCAGTCCC -3'
Posted On2015-04-30