Incidental Mutation 'R4052:Rnf207'
ID314194
Institutional Source Beutler Lab
Gene Symbol Rnf207
Ensembl Gene ENSMUSG00000058498
Gene Namering finger protein 207
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4052 ()
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152307019-152318993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 152311437 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 533 (Q533H)
Ref Sequence ENSEMBL: ENSMUSP00000075540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048892] [ENSMUST00000076183] [ENSMUST00000130008] [ENSMUST00000151372] [ENSMUST00000170820]
Predicted Effect probably benign
Transcript: ENSMUST00000048892
SMART Domains Protein: ENSMUSP00000043390
Gene: ENSMUSG00000039662

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 42 59 N/A INTRINSIC
transmembrane domain 66 85 N/A INTRINSIC
Pfam:PEMT 158 263 2.6e-11 PFAM
Pfam:ICMT 163 257 3.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076183
AA Change: Q533H

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075540
Gene: ENSMUSG00000058498
AA Change: Q533H

DomainStartEndE-ValueType
RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 3.6e-11 PFAM
Pfam:DUF3583 204 378 1.2e-10 PFAM
coiled coil region 422 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127565
Predicted Effect probably benign
Transcript: ENSMUST00000130008
SMART Domains Protein: ENSMUSP00000127196
Gene: ENSMUSG00000058498

DomainStartEndE-ValueType
RING 25 63 5.6e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146496
Predicted Effect probably benign
Transcript: ENSMUST00000151372
SMART Domains Protein: ENSMUSP00000133950
Gene: ENSMUSG00000039662

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 42 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170820
AA Change: Q498H

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129400
Gene: ENSMUSG00000058498
AA Change: Q498H

DomainStartEndE-ValueType
RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 1e-11 PFAM
low complexity region 236 242 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
coiled coil region 387 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik T G 13: 119,488,202 probably benign Het
Abca8b G A 11: 109,981,725 Q17* probably null Het
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ace2 A G X: 164,169,585 I110V probably benign Het
Adam29 T C 8: 55,872,282 Y379C probably damaging Het
Apol10a A T 15: 77,488,985 I274L probably benign Het
BC005537 T A 13: 24,809,898 F119I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Cyp4a30b A G 4: 115,454,342 D69G probably benign Het
Dclk2 A G 3: 86,830,822 probably null Het
Dhx30 A G 9: 110,100,821 V69A possibly damaging Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Dock3 A G 9: 106,973,796 S836P probably damaging Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
Erap1 A G 13: 74,675,340 N831S probably benign Het
Gimap3 T A 6: 48,766,513 T3S possibly damaging Het
Gpr82 C T X: 13,665,659 P149S probably damaging Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Helz2 A G 2: 181,240,475 L175P probably damaging Het
Il1f8 T C 2: 24,159,832 F152L probably damaging Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Lef1 A G 3: 131,194,689 N236D probably damaging Het
Macf1 A G 4: 123,472,017 S1419P probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Ncapd3 T A 9: 27,089,383 probably null Het
Olfr665 A G 7: 104,881,603 T299A probably damaging Het
P2rx7 T C 5: 122,666,277 F293S probably damaging Het
Pabpc1l T C 2: 164,043,613 W429R probably benign Het
Parp14 T C 16: 35,858,401 E399G probably benign Het
Pde6h A G 6: 136,959,268 D3G unknown Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Rasgrp3 T C 17: 75,496,968 F89L probably damaging Het
Rif1 A T 2: 52,098,471 K741* probably null Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Slc24a2 A G 4: 87,227,205 V204A probably damaging Het
Spry2 A T 14: 105,893,201 C184S probably damaging Het
Sulf2 T C 2: 166,094,590 Y152C probably damaging Het
Thrap3 G A 4: 126,176,219 A625V probably damaging Het
Tmem39a T A 16: 38,586,288 V329D probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Trim30b T A 7: 104,357,478 Q57L possibly damaging Het
Uggt1 A G 1: 36,164,489 V1020A probably damaging Het
Zfp941 T G 7: 140,812,427 K340Q possibly damaging Het
Other mutations in Rnf207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Rnf207 APN 4 152318261 splice site probably benign
IGL02325:Rnf207 APN 4 152311780 missense probably damaging 0.97
IGL02451:Rnf207 APN 4 152312412 missense probably benign 0.25
R0311:Rnf207 UTSW 4 152315779 missense probably damaging 1.00
R0462:Rnf207 UTSW 4 152313372 missense possibly damaging 0.78
R0671:Rnf207 UTSW 4 152307468 missense probably benign 0.00
R0845:Rnf207 UTSW 4 152312064 splice site probably benign
R1544:Rnf207 UTSW 4 152313871 splice site probably benign
R1667:Rnf207 UTSW 4 152313215 missense probably benign 0.00
R4335:Rnf207 UTSW 4 152315605 splice site probably benign
R4649:Rnf207 UTSW 4 152312155 missense probably benign 0.06
R5033:Rnf207 UTSW 4 152313209 missense probably benign 0.00
R5268:Rnf207 UTSW 4 152313889 missense probably damaging 1.00
R5603:Rnf207 UTSW 4 152312394 missense probably damaging 1.00
R5938:Rnf207 UTSW 4 152317928 intron probably benign
R6147:Rnf207 UTSW 4 152315655 missense probably damaging 1.00
R6181:Rnf207 UTSW 4 152308848 missense probably benign 0.00
R6866:Rnf207 UTSW 4 152312532 missense possibly damaging 0.81
R7166:Rnf207 UTSW 4 152311780 missense probably damaging 0.98
R7177:Rnf207 UTSW 4 152312177 missense probably benign 0.43
R7354:Rnf207 UTSW 4 152314091 missense probably damaging 0.96
R7893:Rnf207 UTSW 4 152311438 missense probably damaging 0.99
R7976:Rnf207 UTSW 4 152311438 missense probably damaging 0.99
X0026:Rnf207 UTSW 4 152316042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGATGTACCACCACTTCTTAG -3'
(R):5'- TGGCCTTACACCTGCATCTG -3'

Sequencing Primer
(F):5'- GGCAGACCTTTGCAGATTCTAATAC -3'
(R):5'- ACACCTGCATCTGGGGTTG -3'
Posted On2015-04-30