Incidental Mutation 'R4052:Spry2'
ID314221
Institutional Source Beutler Lab
Gene Symbol Spry2
Ensembl Gene ENSMUSG00000022114
Gene Namesprouty RTK signaling antagonist 2
Synonymssprouty2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R4052 ()
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location105891947-105896819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105893201 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 184 (C184S)
Ref Sequence ENSEMBL: ENSMUSP00000022709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022709]
Predicted Effect probably damaging
Transcript: ENSMUST00000022709
AA Change: C184S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022709
Gene: ENSMUSG00000022114
AA Change: C184S

DomainStartEndE-ValueType
low complexity region 107 130 N/A INTRINSIC
Pfam:Sprouty 183 301 2.8e-38 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the sprouty family. The encoded protein contains a carboxyl-terminal cysteine-rich domain essential for the inhibitory activity on receptor tyrosine kinase signaling proteins and is required for growth factor stimulated translocation of the protein to membrane ruffles. In primary dermal endothelial cells this gene is transiently upregulated in response to fibroblast growth factor two. This protein is indirectly involved in the non-cell autonomous inhibitory effect on fibroblast growth factor two signaling. The protein interacts with Cas-Br-M (murine) ectropic retroviral transforming sequence, and can function as a bimodal regulator of epidermal growth factor receptor/mitogen-activated protein kinase signaling. This protein may play a role in alveoli branching during lung development as shown by a similar mouse protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit enteric nerve hyperplasia which led to esophangeal achalasia and intestinal pseudo-obstruction. Mice also have intermediate to severe hearing loss with abnormalities in the organ of Corti and about half die prematurely. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik T G 13: 119,488,202 probably benign Het
Abca8b G A 11: 109,981,725 Q17* probably null Het
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ace2 A G X: 164,169,585 I110V probably benign Het
Adam29 T C 8: 55,872,282 Y379C probably damaging Het
Apol10a A T 15: 77,488,985 I274L probably benign Het
BC005537 T A 13: 24,809,898 F119I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Cyp4a30b A G 4: 115,454,342 D69G probably benign Het
Dclk2 A G 3: 86,830,822 probably null Het
Dhx30 A G 9: 110,100,821 V69A possibly damaging Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Dock3 A G 9: 106,973,796 S836P probably damaging Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
Erap1 A G 13: 74,675,340 N831S probably benign Het
Gimap3 T A 6: 48,766,513 T3S possibly damaging Het
Gpr82 C T X: 13,665,659 P149S probably damaging Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Helz2 A G 2: 181,240,475 L175P probably damaging Het
Il1f8 T C 2: 24,159,832 F152L probably damaging Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Lef1 A G 3: 131,194,689 N236D probably damaging Het
Macf1 A G 4: 123,472,017 S1419P probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Ncapd3 T A 9: 27,089,383 probably null Het
Olfr665 A G 7: 104,881,603 T299A probably damaging Het
P2rx7 T C 5: 122,666,277 F293S probably damaging Het
Pabpc1l T C 2: 164,043,613 W429R probably benign Het
Parp14 T C 16: 35,858,401 E399G probably benign Het
Pde6h A G 6: 136,959,268 D3G unknown Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Rasgrp3 T C 17: 75,496,968 F89L probably damaging Het
Rif1 A T 2: 52,098,471 K741* probably null Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Rnf207 C A 4: 152,311,437 Q533H probably benign Het
Slc24a2 A G 4: 87,227,205 V204A probably damaging Het
Sulf2 T C 2: 166,094,590 Y152C probably damaging Het
Thrap3 G A 4: 126,176,219 A625V probably damaging Het
Tmem39a T A 16: 38,586,288 V329D probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Trim30b T A 7: 104,357,478 Q57L possibly damaging Het
Uggt1 A G 1: 36,164,489 V1020A probably damaging Het
Zfp941 T G 7: 140,812,427 K340Q possibly damaging Het
Other mutations in Spry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Spry2 APN 14 105893054 missense probably damaging 1.00
eagle UTSW 14 105893357 nonsense probably null
Osprey UTSW 14 105892984 missense possibly damaging 0.92
R0016:Spry2 UTSW 14 105893297 missense probably benign 0.08
R0594:Spry2 UTSW 14 105893310 missense possibly damaging 0.50
R0843:Spry2 UTSW 14 105893090 missense probably damaging 1.00
R0943:Spry2 UTSW 14 105893587 missense probably damaging 1.00
R1186:Spry2 UTSW 14 105892907 missense probably damaging 1.00
R5355:Spry2 UTSW 14 105893278 missense probably damaging 0.97
R6306:Spry2 UTSW 14 105892984 missense possibly damaging 0.92
R6822:Spry2 UTSW 14 105893357 nonsense probably null
R7347:Spry2 UTSW 14 105893512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAACAATGGGACTGGCTGC -3'
(R):5'- TCTCGGAGCAGTACAAGGAC -3'

Sequencing Primer
(F):5'- CAAGAGCACGGGTTGTCAGC -3'
(R):5'- CTCGGAGCAGTACAAGGACAAGTAC -3'
Posted On2015-04-30