Mutagenetix > Incidental Mutation

Incidental Mutation 'R4056:Rims1'

314233

Institutional Source

Beutler Lab

Gene Symbol

Rims1

Ensembl Gene

ENSMUSG00000041670

Gene Name

regulating synaptic membrane exocytosis 1

Synonyms

RIM1a, RIM1, RIM1alpha, C030033M19Rik

MMRRC Submission

041617-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.703) question?

Stock #

R4056 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22286251-22805994 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 22292939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273] [ENSMUST00000164877]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000081544

SMART Domains

Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	2.6e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	899	934	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC
C2	1120	1223	7.45e-15	SMART
low complexity region	1245	1253	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097809

SMART Domains

Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	1e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	862	874	N/A	INTRINSIC
low complexity region	974	1009	N/A	INTRINSIC
low complexity region	1086	1100	N/A	INTRINSIC
C2	1195	1298	7.45e-15	SMART
low complexity region	1320	1328	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097810

SMART Domains

Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
PDB:2CJS\|C	131	193	2e-32	PDB
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	862	874	N/A	INTRINSIC
low complexity region	916	929	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
low complexity region	1147	1161	N/A	INTRINSIC
C2	1256	1359	7.45e-15	SMART
low complexity region	1381	1389	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097811

SMART Domains

Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	1.6e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	867	881	N/A	INTRINSIC
low complexity region	944	957	N/A	INTRINSIC
low complexity region	1063	1098	N/A	INTRINSIC
low complexity region	1175	1189	N/A	INTRINSIC
C2	1284	1387	7.45e-15	SMART
low complexity region	1409	1417	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115273

SMART Domains

Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	2.8e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	950	985	N/A	INTRINSIC
low complexity region	1062	1076	N/A	INTRINSIC
C2	1171	1274	7.45e-15	SMART
low complexity region	1296	1304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164877

SMART Domains

Protein: ENSMUSP00000131808
Gene: ENSMUSG00000041670

Domain	Start	End	E-Value	Type
C2	79	182	7.45e-15	SMART
low complexity region	204	212	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185942

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730455P16Rik	T	A	11: 80,375,503		probably benign	Het
Abcf1	A	G	17: 35,959,915	I510T	possibly damaging	Het
Adamts18	T	A	8: 113,737,580	K749*	probably null	Het
Alms1	A	G	6: 85,587,803	E53G	unknown	Het
Bmper	A	G	9: 23,399,629	H453R	probably benign	Het
Btg1	T	A	10: 96,618,354	M1K	probably null	Het
Cntfr	A	G	4: 41,658,900	I277T	probably damaging	Het
Col6a4	C	A	9: 106,026,466	R1642I	probably damaging	Het
Ctnna3	T	C	10: 65,002,568	I808T	probably damaging	Het
Cyp1a1	T	A	9: 57,700,149	V20D	probably benign	Het
Dnah17	T	C	11: 118,070,538	T2554A	probably benign	Het
Fcgbp	A	T	7: 28,104,116	Q1715L	probably benign	Het
Gabarapl1	T	C	6: 129,538,630	F77S	probably damaging	Het
Gm1966	G	T	7: 106,604,009	D9E	possibly damaging	Het
Hpse2	T	C	19: 43,294,275	K180E	probably damaging	Het
Hs3st2	T	A	7: 121,500,702	L257Q	probably damaging	Het
Ighv1-18	T	C	12: 114,682,667	T106A	probably benign	Het
Ints2	A	C	11: 86,242,952	L424R	probably damaging	Het
Iqgap2	A	G	13: 95,750,033	V114A	probably damaging	Het
Kalrn	A	T	16: 34,314,209	I401N	probably damaging	Het
Maats1	A	G	16: 38,298,214	V741A	probably benign	Het
Mast2	T	A	4: 116,337,501		probably benign	Het
Myo18a	A	G	11: 77,812,013	E5G	possibly damaging	Het
Nav3	A	T	10: 109,880,533		probably null	Het
Net1	G	A	13: 3,884,949	T359I	probably damaging	Het
Pcsk9	T	A	4: 106,444,702	H616L	probably benign	Het
Plekha5	G	T	6: 140,589,232	V597L	possibly damaging	Het
Plekhg3	T	A	12: 76,565,247	I374N	probably damaging	Het
Pros1	A	T	16: 62,900,645	R188*	probably null	Het
Rhbg	C	T	3: 88,243,448	V434I	probably damaging	Het
Rxfp2	T	C	5: 150,051,633		probably null	Het
Sbf2	T	C	7: 110,441,466	I385V	probably damaging	Het
Slc22a23	A	C	13: 34,299,004	Y181*	probably null	Het
Spata31	T	A	13: 64,921,655	V539E	probably benign	Het
Trpv5	G	A	6: 41,659,705	R436C	probably damaging	Het
Vmn1r13	G	A	6: 57,209,985	C43Y	probably benign	Het
Wif1	G	A	10: 121,082,194	V156I	probably benign	Het
Zfyve16	T	C	13: 92,504,549	N1229S	probably damaging	Het

Other mutations in Rims1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Rims1	APN	1	22468242	missense	probably damaging	1.00
IGL00535:Rims1	APN	1	22432921	missense	probably benign	0.02
IGL01021:Rims1	APN	1	22486620	missense	probably damaging	1.00
IGL01106:Rims1	APN	1	22379447	missense	probably damaging	1.00
IGL01128:Rims1	APN	1	22534175	missense	probably damaging	0.97
IGL01548:Rims1	APN	1	22538602	missense	probably damaging	1.00
IGL01688:Rims1	APN	1	22397540	missense	probably benign	0.22
IGL02089:Rims1	APN	1	22630475	missense	possibly damaging	0.68
IGL02245:Rims1	APN	1	22346488	missense	probably damaging	0.98
IGL02355:Rims1	APN	1	22483207	missense	probably damaging	1.00
IGL02362:Rims1	APN	1	22483207	missense	probably damaging	1.00
IGL02682:Rims1	APN	1	22288484	missense	probably damaging	1.00
IGL03006:Rims1	APN	1	22296954	missense	probably damaging	0.99
IGL03054:Rims1	UTSW	1	22290109	missense	probably damaging	1.00
PIT4504001:Rims1	UTSW	1	22397460	missense
R0031:Rims1	UTSW	1	22296879	missense	probably damaging	1.00
R0118:Rims1	UTSW	1	22346407	missense	probably damaging	1.00
R0390:Rims1	UTSW	1	22596526	missense	possibly damaging	0.92
R0483:Rims1	UTSW	1	22468182	splice site	probably benign
R0744:Rims1	UTSW	1	22427459	splice site	probably null
R0836:Rims1	UTSW	1	22427459	splice site	probably null
R1218:Rims1	UTSW	1	22483175	missense	probably damaging	1.00
R1228:Rims1	UTSW	1	22472756	missense	probably null	1.00
R1374:Rims1	UTSW	1	22296948	missense	probably damaging	1.00
R1474:Rims1	UTSW	1	22538281	splice site	probably benign
R1652:Rims1	UTSW	1	22292866	missense	probably damaging	1.00
R1712:Rims1	UTSW	1	22296948	missense	probably damaging	1.00
R1730:Rims1	UTSW	1	22346529	critical splice acceptor site	probably null
R1783:Rims1	UTSW	1	22346529	critical splice acceptor site	probably null
R1861:Rims1	UTSW	1	22596558	missense	probably damaging	1.00
R1899:Rims1	UTSW	1	22428474	missense	probably damaging	1.00
R1937:Rims1	UTSW	1	22288530	missense	probably damaging	1.00
R2010:Rims1	UTSW	1	22296996	missense	probably damaging	1.00
R2049:Rims1	UTSW	1	22596435	missense	probably damaging	1.00
R2124:Rims1	UTSW	1	22404508	nonsense	probably null
R2860:Rims1	UTSW	1	22432976	missense	probably benign	0.01
R2861:Rims1	UTSW	1	22432976	missense	probably benign	0.01
R2914:Rims1	UTSW	1	22805630	missense	probably damaging	1.00
R3740:Rims1	UTSW	1	22373443	missense	probably damaging	1.00
R3741:Rims1	UTSW	1	22373443	missense	probably damaging	1.00
R3773:Rims1	UTSW	1	22421810	missense	probably damaging	1.00
R3874:Rims1	UTSW	1	22428489	missense	probably damaging	1.00
R3901:Rims1	UTSW	1	22533497	missense	probably benign	0.00
R3964:Rims1	UTSW	1	22427459	splice site	probably null
R4037:Rims1	UTSW	1	22475712	missense	probably damaging	0.96
R4039:Rims1	UTSW	1	22475712	missense	probably damaging	0.96
R4062:Rims1	UTSW	1	22533583	missense	probably benign	0.00
R4552:Rims1	UTSW	1	22373494	missense	probably damaging	0.99
R4658:Rims1	UTSW	1	22427543	missense	probably damaging	0.98
R4688:Rims1	UTSW	1	22479447	nonsense	probably null
R4696:Rims1	UTSW	1	22288612	missense	probably damaging	1.00
R4720:Rims1	UTSW	1	22427481	missense	probably damaging	1.00
R4764:Rims1	UTSW	1	22479462	missense	probably damaging	1.00
R4780:Rims1	UTSW	1	22291105	missense	probably damaging	1.00
R4931:Rims1	UTSW	1	22533947	missense	probably benign	0.26
R5137:Rims1	UTSW	1	22288620	nonsense	probably null
R5153:Rims1	UTSW	1	22483247	nonsense	probably null
R5305:Rims1	UTSW	1	22596542	missense	probably damaging	0.99
R5354:Rims1	UTSW	1	22538511	missense	probably damaging	1.00
R5386:Rims1	UTSW	1	22412245	missense	probably damaging	0.99
R5485:Rims1	UTSW	1	22483208	missense	possibly damaging	0.93
R5643:Rims1	UTSW	1	22538509	missense	probably damaging	1.00
R5929:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
R5988:Rims1	UTSW	1	22596463	missense	probably damaging	1.00
R6160:Rims1	UTSW	1	22432984	missense	probably damaging	0.98
R6579:Rims1	UTSW	1	22425916	missense	probably damaging	1.00
R6790:Rims1	UTSW	1	22468197	missense	probably damaging	1.00
R7048:Rims1	UTSW	1	22472820	missense	probably damaging	1.00
R7100:Rims1	UTSW	1	22346473	missense	probably benign	0.27
R7155:Rims1	UTSW	1	22432923	missense	probably damaging	0.99
R7171:Rims1	UTSW	1	22428489	missense
R7448:Rims1	UTSW	1	22404475	missense
R7505:Rims1	UTSW	1	22533996	missense	possibly damaging	0.55
R7567:Rims1	UTSW	1	22468210	missense	probably damaging	0.99
R7639:Rims1	UTSW	1	22805669	missense	probably benign	0.02
R7955:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
R8005:Rims1	UTSW	1	22412213	missense
R8071:Rims1	UTSW	1	22288536	nonsense	probably null
R8465:Rims1	UTSW	1	22428480	missense	possibly damaging	0.89
R8517:Rims1	UTSW	1	22483165	missense	probably damaging	1.00
R8703:Rims1	UTSW	1	22425887	missense
R8726:Rims1	UTSW	1	22594100	missense	possibly damaging	0.88
R9090:Rims1	UTSW	1	22428522	missense
R9179:Rims1	UTSW	1	22412266	missense	probably damaging	0.99
R9271:Rims1	UTSW	1	22428522	missense
R9291:Rims1	UTSW	1	22397522	missense
R9394:Rims1	UTSW	1	22472775	missense	probably damaging	1.00
R9578:Rims1	UTSW	1	22484742	missense	probably damaging	1.00
R9614:Rims1	UTSW	1	22421745	nonsense	probably null
R9726:Rims1	UTSW	1	22630412	missense	probably null	0.21
Z1088:Rims1	UTSW	1	22288586	missense	probably damaging	1.00
Z1176:Rims1	UTSW	1	22484671	nonsense	probably null
Z1177:Rims1	UTSW	1	22296939	missense	possibly damaging	0.93
Z1177:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
Z1177:Rims1	UTSW	1	22472777	missense	probably benign	0.44
Z1177:Rims1	UTSW	1	22472804	missense	probably damaging	1.00
Z1186:Rims1	UTSW	1	22379482	missense

Predicted Primers

PCR Primer
(F):5'- TGTTGTGATCCTTCAATGTCATTTAT -3'
(R):5'- TAAAACTCCCTCCTCCCAGT -3'

Sequencing Primer
(F):5'- TACTTTATGTGCGAGAACAGCG -3'
(R):5'- CCTCCCAGTCAGATGAAGTGTTGAG -3'

Posted On

2015-04-30