Incidental Mutation 'R0388:Mmp19'
ID 31424
Institutional Source Beutler Lab
Gene Symbol Mmp19
Ensembl Gene ENSMUSG00000025355
Gene Name matrix metallopeptidase 19
Synonyms
MMRRC Submission 038594-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock # R0388 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 128790910-128800824 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 128798883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 456 (R456L)
Ref Sequence ENSEMBL: ENSMUSP00000026411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026411] [ENSMUST00000051011] [ENSMUST00000139227] [ENSMUST00000219404]
AlphaFold Q9JHI0
Predicted Effect probably benign
Transcript: ENSMUST00000026411
AA Change: R456L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000026411
Gene: ENSMUSG00000025355
AA Change: R456L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:PG_binding_1 26 81 6.7e-10 PFAM
ZnMc 101 258 5.13e-43 SMART
low complexity region 262 271 N/A INTRINSIC
HX 293 335 8.97e-8 SMART
HX 337 378 1e-5 SMART
HX 380 427 1.87e-5 SMART
HX 429 471 3.7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051011
SMART Domains Protein: ENSMUSP00000050451
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 43 240 2.4e-47 PFAM
low complexity region 257 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139227
SMART Domains Protein: ENSMUSP00000118082
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 96 4.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152966
SMART Domains Protein: ENSMUSP00000117574
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 241 1.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219404
AA Change: R384L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219535
Meta Mutation Damage Score 0.3111 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein develop a diet-induced obesity due to adipocyte hypertophy, exhibit decreased susceptibility to chemical carcinogen-induced skin tumors and early onset of tumoral angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for one knock-out allele develop diet-induced obesity due to adipocyte hypertrophy and display decreased incidence of chemically-induced fibrosarcomas while another knock-out mutant shows a reduced inflammatory reaction to contact hypersensitivity and abnormal T cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Mmp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Mmp19 APN 10 128798142 missense probably damaging 0.99
IGL01654:Mmp19 APN 10 128798520 missense probably damaging 1.00
IGL02009:Mmp19 APN 10 128798487 missense probably benign
IGL02110:Mmp19 APN 10 128794858 missense probably damaging 0.97
H8562:Mmp19 UTSW 10 128795601 missense probably benign
I0000:Mmp19 UTSW 10 128798460 missense probably benign 0.38
R0183:Mmp19 UTSW 10 128799003 missense possibly damaging 0.49
R1481:Mmp19 UTSW 10 128798178 missense possibly damaging 0.82
R2073:Mmp19 UTSW 10 128794979 missense probably damaging 1.00
R2443:Mmp19 UTSW 10 128798856 missense possibly damaging 0.46
R2495:Mmp19 UTSW 10 128790950 utr 5 prime probably benign
R4477:Mmp19 UTSW 10 128795637 missense probably benign 0.01
R5293:Mmp19 UTSW 10 128791101 missense probably damaging 1.00
R6567:Mmp19 UTSW 10 128796406 missense probably benign
R6932:Mmp19 UTSW 10 128791654 missense probably benign 0.16
R7338:Mmp19 UTSW 10 128799083 missense probably benign 0.00
R7611:Mmp19 UTSW 10 128798988 missense probably benign
R8515:Mmp19 UTSW 10 128795602 missense probably benign 0.01
R8704:Mmp19 UTSW 10 128798834 missense probably benign 0.06
R9417:Mmp19 UTSW 10 128794654 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCTCAGGATACTGGCAATGGGATG -3'
(R):5'- TGAATAGTTCTCAGGCCCCTAGCAG -3'

Sequencing Primer
(F):5'- TACTGGCAATGGGATGAACTG -3'
(R):5'- CCTAGCAGGGTGACATTAGC -3'
Posted On 2013-04-24