Mutagenetix > Incidental Mutation

Incidental Mutation 'R0388:Tns3'

31425

Institutional Source

Beutler Lab

Gene Symbol

Tns3

Ensembl Gene

ENSMUSG00000020422

Gene Name

tensin 3

Synonyms

TEM6, F830010I22Rik, Tens1

MMRRC Submission

038594-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.345) question?

Stock #

R0388 (G1)

Quality Score

218

Status

Validated

Chromosome

Chromosomal Location

8431652-8664535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8445703 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1234 (I1234V)

Ref Sequence

ENSEMBL: ENSMUSP00000020695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020695]

AlphaFold

Q5SSZ5

Predicted Effect

probably benign
Transcript: ENSMUST00000020695
AA Change: I1234V

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: I1234V

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	1	171	5e-28	SMART
PTEN_C2	173	300	1.15e-48	SMART
low complexity region	854	864	N/A	INTRINSIC
low complexity region	1102	1126	N/A	INTRINSIC
SH2	1165	1268	1.32e-18	SMART
PTB	1301	1438	3.14e-24	SMART

Meta Mutation Damage Score

0.1477

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.6%
20x: 90.7%

Validation Efficiency

100% (67/67)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,159		probably benign	Het
Acsbg1	T	C	9: 54,609,063	K678R	probably damaging	Het
Adgrg6	A	G	10: 14,450,658	I410T	probably benign	Het
Afap1l2	A	C	19: 56,917,242		probably benign	Het
Aox2	T	C	1: 58,354,406	Y1242H	probably damaging	Het
Apoo-ps	T	C	13: 107,414,673		noncoding transcript	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Cdh3	C	A	8: 106,539,129	T268K	probably damaging	Het
Chd5	T	A	4: 152,371,644	H923Q	probably damaging	Het
Chd7	T	C	4: 8,854,560	V1967A	probably benign	Het
Cntn3	T	C	6: 102,277,316	M222V	probably damaging	Het
Dcaf17	A	G	2: 71,078,571	K277R	probably benign	Het
Dmbt1	T	C	7: 131,096,049		probably benign	Het
Dmpk	T	A	7: 19,084,077		probably benign	Het
Dzank1	A	T	2: 144,476,106	L714Q	possibly damaging	Het
Efcab3	A	G	11: 105,109,401	D272G	possibly damaging	Het
Erbb2	G	C	11: 98,427,351	R471P	possibly damaging	Het
Esf1	T	A	2: 140,120,871	Y760F	possibly damaging	Het
Fanci	C	A	7: 79,439,630	T938K	probably benign	Het
Gnai3	A	G	3: 108,115,757		probably benign	Het
Hspg2	T	A	4: 137,511,158	C319S	probably damaging	Het
Il12a	T	A	3: 68,695,187		probably null	Het
Inpp4a	A	G	1: 37,396,160	D837G	probably damaging	Het
Kcnj5	T	A	9: 32,317,863	E13V	probably damaging	Het
Kcnq3	T	A	15: 66,000,038	Y594F	probably benign	Het
Kif16b	T	C	2: 142,740,937	E556G	probably damaging	Het
Kif28	T	C	1: 179,740,089	I39V	possibly damaging	Het
Lgi2	T	C	5: 52,554,549	E143G	probably damaging	Het
Mast1	T	G	8: 84,915,537	I1063L	probably benign	Het
Med12l	T	C	3: 59,093,504		probably benign	Het
Mmp19	G	T	10: 128,798,883	R456L	probably benign	Het
Mon1b	T	A	8: 113,639,078	V346E	probably damaging	Het
Mpv17l	A	T	16: 13,940,999	I96L	probably benign	Het
Mrgpra9	A	T	7: 47,252,794	M1K	probably null	Het
Mycbp2	A	T	14: 103,156,667	H2819Q	probably benign	Het
Nav1	A	C	1: 135,448,917		probably benign	Het
Neurl4	T	C	11: 69,911,733		probably benign	Het
Ntng2	G	C	2: 29,207,426	P341R	probably damaging	Het
Oas1d	A	T	5: 120,917,028	Y221F	probably damaging	Het
Olfr1040	A	G	2: 86,146,630	Y35H	probably damaging	Het
Olfr348	C	A	2: 36,786,862	D112E	probably benign	Het
Olfr365	A	C	2: 37,202,184		probably null	Het
Osbpl8	A	G	10: 111,272,282	M380V	probably benign	Het
Pank1	T	C	19: 34,821,706		probably benign	Het
Parn	T	C	16: 13,654,476	D169G	possibly damaging	Het
Pknox1	T	A	17: 31,603,192	I311N	probably damaging	Het
Pprc1	T	C	19: 46,062,775	V248A	possibly damaging	Het
Prkcq	T	C	2: 11,254,234	C322R	probably benign	Het
Ptpn13	T	A	5: 103,555,062	I1298N	probably benign	Het
Rab11fip3	A	G	17: 26,069,072	S36P	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sass6	C	A	3: 116,607,308		probably benign	Het
Shroom3	G	A	5: 92,951,293	G1463D	probably benign	Het
Slc35d1	A	T	4: 103,184,887	Y249*	probably null	Het
Slc9a3	C	T	13: 74,121,536	P8S	unknown	Het
Slc9a9	T	A	9: 94,939,563		probably null	Het
Syne2	T	A	12: 75,986,975	M3666K	probably benign	Het
Synpo2	A	G	3: 123,079,897	V1140A	probably benign	Het
Thada	A	G	17: 84,231,096	F1495L	probably benign	Het
Timeless	A	G	10: 128,241,425		probably null	Het
Tlr6	G	T	5: 64,955,205	H120N	possibly damaging	Het
Tmem173	A	G	18: 35,735,111		probably null	Het
Ttll9	A	G	2: 153,000,179	S318G	probably benign	Het
Vps13c	T	C	9: 67,922,915		probably benign	Het
Zfp933	T	C	4: 147,826,442	I232M	probably benign	Het
Zfyve27	T	C	19: 42,189,585	S382P	probably damaging	Het

Other mutations in Tns3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tns3	APN	11	8451066	missense	probably benign	0.42
IGL00822:Tns3	APN	11	8443976	missense	probably damaging	0.99
IGL01075:Tns3	APN	11	8478399	missense	probably benign	0.45
IGL01286:Tns3	APN	11	8492617	missense	probably benign	0.01
IGL01680:Tns3	APN	11	8548937	missense	probably damaging	1.00
IGL01687:Tns3	APN	11	8492798	missense	probably damaging	1.00
IGL01734:Tns3	APN	11	8519192	splice site	probably benign
IGL01844:Tns3	APN	11	8437177	missense	possibly damaging	0.58
IGL01984:Tns3	APN	11	8548992	nonsense	probably null
IGL02137:Tns3	APN	11	8492578	missense	possibly damaging	0.93
IGL02273:Tns3	APN	11	8434531	missense	probably damaging	1.00
IGL02623:Tns3	APN	11	8437141	missense	probably damaging	1.00
IGL02697:Tns3	APN	11	8492346	missense	probably benign	0.00
IGL02829:Tns3	APN	11	8519564	missense	probably damaging	1.00
ANU74:Tns3	UTSW	11	8492149	missense	probably benign	0.38
R0020:Tns3	UTSW	11	8545227	critical splice donor site	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0370:Tns3	UTSW	11	8445730	missense	possibly damaging	0.80
R0410:Tns3	UTSW	11	8435852	missense	probably benign	0.02
R0496:Tns3	UTSW	11	8547262	splice site	probably benign
R0562:Tns3	UTSW	11	8493262	missense	possibly damaging	0.93
R0626:Tns3	UTSW	11	8493121	missense	probably benign	0.04
R0736:Tns3	UTSW	11	8519474	missense	possibly damaging	0.94
R0893:Tns3	UTSW	11	8493302	missense	probably damaging	1.00
R1367:Tns3	UTSW	11	8448704	missense	probably benign	0.01
R1386:Tns3	UTSW	11	8518261	missense	probably benign	0.02
R1975:Tns3	UTSW	11	8435738	missense	probably benign	0.04
R2205:Tns3	UTSW	11	8531719	missense	probably damaging	1.00
R2319:Tns3	UTSW	11	8541200	missense	probably damaging	1.00
R2830:Tns3	UTSW	11	8435870	missense	probably damaging	1.00
R3720:Tns3	UTSW	11	8492999	missense	probably damaging	1.00
R3765:Tns3	UTSW	11	8451133	missense	probably benign	0.00
R3817:Tns3	UTSW	11	8434619	missense	probably damaging	1.00
R4058:Tns3	UTSW	11	8492275	missense	probably damaging	1.00
R4599:Tns3	UTSW	11	8531747	missense	probably damaging	1.00
R4631:Tns3	UTSW	11	8451119	missense	probably benign	0.30
R4731:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4732:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4733:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R5472:Tns3	UTSW	11	8451092	missense	probably benign
R5749:Tns3	UTSW	11	8451177	missense	probably benign	0.01
R5807:Tns3	UTSW	11	8493211	missense	probably damaging	1.00
R5844:Tns3	UTSW	11	8434580	missense	probably damaging	1.00
R5942:Tns3	UTSW	11	8435860	missense	probably damaging	1.00
R5982:Tns3	UTSW	11	8492245	missense	probably damaging	0.99
R6025:Tns3	UTSW	11	8492578	missense	possibly damaging	0.93
R6266:Tns3	UTSW	11	8492987	missense	probably damaging	1.00
R6322:Tns3	UTSW	11	8492147	missense	probably benign	0.01
R6536:Tns3	UTSW	11	8434531	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549057	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549058	missense	probably damaging	1.00
R6864:Tns3	UTSW	11	8493196	missense	probably damaging	1.00
R6897:Tns3	UTSW	11	8531743	missense	probably damaging	1.00
R7108:Tns3	UTSW	11	8437251	missense	probably benign	0.00
R7443:Tns3	UTSW	11	8451442	missense	probably benign	0.01
R7459:Tns3	UTSW	11	8492793	missense	probably benign	0.16
R7474:Tns3	UTSW	11	8530894	missense	probably damaging	1.00
R7576:Tns3	UTSW	11	8541192	missense	possibly damaging	0.78
R7979:Tns3	UTSW	11	8492701	missense	probably benign	0.01
R8055:Tns3	UTSW	11	8545343	missense	probably damaging	1.00
R8057:Tns3	UTSW	11	8492773	missense	probably benign
R8077:Tns3	UTSW	11	8445667	missense	probably damaging	1.00
R8518:Tns3	UTSW	11	8492971	missense	probably damaging	0.96
R8523:Tns3	UTSW	11	8448779	missense	probably damaging	1.00
R8790:Tns3	UTSW	11	8518273	missense	probably damaging	0.99
R9228:Tns3	UTSW	11	8450094	missense	probably damaging	1.00
R9374:Tns3	UTSW	11	8492606	missense	probably damaging	1.00
R9476:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9510:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9594:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9595:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9596:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9624:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9629:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
T0975:Tns3	UTSW	11	8451146	missense	probably benign	0.00
T0975:Tns3	UTSW	11	8479518	missense	probably benign
T0975:Tns3	UTSW	11	8549100	start gained	probably benign
X0005:Tns3	UTSW	11	8451224	missense	probably benign	0.00
X0005:Tns3	UTSW	11	8479518	missense	probably benign
Z1177:Tns3	UTSW	11	8451014	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGAACAACTGCCCCTTCAGCTTATC -3'
(R):5'- GCCCAGTAGTGCAGTGGTTTAATCC -3'

Sequencing Primer
(F):5'- TCAGCTTATCTTAAAGACCTCACG -3'
(R):5'- GGAGCCTTCTTAAGTGTAGCCC -3'

Posted On

2013-04-24