Mutagenetix > Incidental Mutation

Incidental Mutation 'R4056:Pros1'

314270

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

041617-MU

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4056 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 62900645 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 188 (R188*)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

probably null
Transcript: ENSMUST00000023629
AA Change: R188*

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: R188*

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155940

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730455P16Rik	T	A	11: 80,375,503		probably benign	Het
Abcf1	A	G	17: 35,959,915	I510T	possibly damaging	Het
Adamts18	T	A	8: 113,737,580	K749*	probably null	Het
Alms1	A	G	6: 85,587,803	E53G	unknown	Het
Bmper	A	G	9: 23,399,629	H453R	probably benign	Het
Btg1	T	A	10: 96,618,354	M1K	probably null	Het
Cntfr	A	G	4: 41,658,900	I277T	probably damaging	Het
Col6a4	C	A	9: 106,026,466	R1642I	probably damaging	Het
Ctnna3	T	C	10: 65,002,568	I808T	probably damaging	Het
Cyp1a1	T	A	9: 57,700,149	V20D	probably benign	Het
Dnah17	T	C	11: 118,070,538	T2554A	probably benign	Het
Fcgbp	A	T	7: 28,104,116	Q1715L	probably benign	Het
Gabarapl1	T	C	6: 129,538,630	F77S	probably damaging	Het
Gm1966	G	T	7: 106,604,009	D9E	possibly damaging	Het
Hpse2	T	C	19: 43,294,275	K180E	probably damaging	Het
Hs3st2	T	A	7: 121,500,702	L257Q	probably damaging	Het
Ighv1-18	T	C	12: 114,682,667	T106A	probably benign	Het
Ints2	A	C	11: 86,242,952	L424R	probably damaging	Het
Iqgap2	A	G	13: 95,750,033	V114A	probably damaging	Het
Kalrn	A	T	16: 34,314,209	I401N	probably damaging	Het
Maats1	A	G	16: 38,298,214	V741A	probably benign	Het
Mast2	T	A	4: 116,337,501		probably benign	Het
Myo18a	A	G	11: 77,812,013	E5G	possibly damaging	Het
Nav3	A	T	10: 109,880,533		probably null	Het
Net1	G	A	13: 3,884,949	T359I	probably damaging	Het
Pcsk9	T	A	4: 106,444,702	H616L	probably benign	Het
Plekha5	G	T	6: 140,589,232	V597L	possibly damaging	Het
Plekhg3	T	A	12: 76,565,247	I374N	probably damaging	Het
Rhbg	C	T	3: 88,243,448	V434I	probably damaging	Het
Rims1	A	G	1: 22,292,939		probably benign	Het
Rxfp2	T	C	5: 150,051,633		probably null	Het
Sbf2	T	C	7: 110,441,466	I385V	probably damaging	Het
Slc22a23	A	C	13: 34,299,004	Y181*	probably null	Het
Spata31	T	A	13: 64,921,655	V539E	probably benign	Het
Trpv5	G	A	6: 41,659,705	R436C	probably damaging	Het
Vmn1r13	G	A	6: 57,209,985	C43Y	probably benign	Het
Wif1	G	A	10: 121,082,194	V156I	probably benign	Het
Zfyve16	T	C	13: 92,504,549	N1229S	probably damaging	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GGCCAAGCTGCTTTTACTTGC -3'
(R):5'- TTCCTCGTGGACATAGAGGC -3'

Sequencing Primer
(F):5'- TTCTGTAAGCCCGGCTGG -3'
(R):5'- CTCGTGGACATAGAGGCACATTTC -3'

Posted On

2015-04-30