Incidental Mutation 'R4056:Pros1'
ID 314270
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Name protein S (alpha)
Synonyms protein S
MMRRC Submission 041617-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4056 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 62674670-62749709 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 62721008 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 188 (R188*)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
AlphaFold Q08761
Predicted Effect probably null
Transcript: ENSMUST00000023629
AA Change: R188*
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: R188*

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155940
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,266,329 (GRCm39) probably benign Het
Abcf1 A G 17: 36,270,807 (GRCm39) I510T possibly damaging Het
Adamts18 T A 8: 114,464,212 (GRCm39) K749* probably null Het
Alms1 A G 6: 85,564,785 (GRCm39) E53G unknown Het
Bmper A G 9: 23,310,925 (GRCm39) H453R probably benign Het
Btg1 T A 10: 96,454,216 (GRCm39) M1K probably null Het
Cfap91 A G 16: 38,118,576 (GRCm39) V741A probably benign Het
Cntfr A G 4: 41,658,900 (GRCm39) I277T probably damaging Het
Col6a4 C A 9: 105,903,665 (GRCm39) R1642I probably damaging Het
Ctnna3 T C 10: 64,838,347 (GRCm39) I808T probably damaging Het
Cyp1a1 T A 9: 57,607,432 (GRCm39) V20D probably benign Het
Dnah17 T C 11: 117,961,364 (GRCm39) T2554A probably benign Het
Fcgbp A T 7: 27,803,541 (GRCm39) Q1715L probably benign Het
Gabarapl1 T C 6: 129,515,593 (GRCm39) F77S probably damaging Het
Gvin3 G T 7: 106,203,216 (GRCm39) D9E possibly damaging Het
Hpse2 T C 19: 43,282,714 (GRCm39) K180E probably damaging Het
Hs3st2 T A 7: 121,099,925 (GRCm39) L257Q probably damaging Het
Ighv1-18 T C 12: 114,646,287 (GRCm39) T106A probably benign Het
Ints2 A C 11: 86,133,778 (GRCm39) L424R probably damaging Het
Iqgap2 A G 13: 95,886,541 (GRCm39) V114A probably damaging Het
Kalrn A T 16: 34,134,579 (GRCm39) I401N probably damaging Het
Mast2 T A 4: 116,194,698 (GRCm39) probably benign Het
Myo18a A G 11: 77,702,839 (GRCm39) E5G possibly damaging Het
Nav3 A T 10: 109,716,394 (GRCm39) probably null Het
Net1 G A 13: 3,934,949 (GRCm39) T359I probably damaging Het
Pcsk9 T A 4: 106,301,899 (GRCm39) H616L probably benign Het
Plekha5 G T 6: 140,534,958 (GRCm39) V597L possibly damaging Het
Plekhg3 T A 12: 76,612,021 (GRCm39) I374N probably damaging Het
Rhbg C T 3: 88,150,755 (GRCm39) V434I probably damaging Het
Rims1 A G 1: 22,363,163 (GRCm39) probably benign Het
Rxfp2 T C 5: 149,975,098 (GRCm39) probably null Het
Sbf2 T C 7: 110,040,673 (GRCm39) I385V probably damaging Het
Slc22a23 A C 13: 34,482,987 (GRCm39) Y181* probably null Het
Spata31 T A 13: 65,069,469 (GRCm39) V539E probably benign Het
Trpv5 G A 6: 41,636,639 (GRCm39) R436C probably damaging Het
Vmn1r13 G A 6: 57,186,970 (GRCm39) C43Y probably benign Het
Wif1 G A 10: 120,918,099 (GRCm39) V156I probably benign Het
Zfyve16 T C 13: 92,641,057 (GRCm39) N1229S probably damaging Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62,730,408 (GRCm39) missense probably damaging 0.99
IGL01300:Pros1 APN 16 62,734,174 (GRCm39) missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62,719,308 (GRCm39) missense probably damaging 0.99
IGL03080:Pros1 APN 16 62,738,506 (GRCm39) missense probably damaging 0.98
IGL03095:Pros1 APN 16 62,728,132 (GRCm39) nonsense probably null
F6893:Pros1 UTSW 16 62,745,002 (GRCm39) missense probably damaging 0.98
R0124:Pros1 UTSW 16 62,734,309 (GRCm39) missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62,723,881 (GRCm39) missense probably benign 0.03
R1113:Pros1 UTSW 16 62,734,228 (GRCm39) missense probably damaging 0.99
R1308:Pros1 UTSW 16 62,734,228 (GRCm39) missense probably damaging 0.99
R1355:Pros1 UTSW 16 62,739,921 (GRCm39) missense probably benign 0.23
R1370:Pros1 UTSW 16 62,739,921 (GRCm39) missense probably benign 0.23
R1517:Pros1 UTSW 16 62,705,875 (GRCm39) missense probably damaging 0.98
R1866:Pros1 UTSW 16 62,748,498 (GRCm39) missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62,723,881 (GRCm39) missense probably damaging 0.96
R2255:Pros1 UTSW 16 62,723,935 (GRCm39) missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62,734,211 (GRCm39) missense probably damaging 0.99
R2369:Pros1 UTSW 16 62,748,432 (GRCm39) missense probably damaging 1.00
R2979:Pros1 UTSW 16 62,734,229 (GRCm39) missense probably damaging 0.99
R3724:Pros1 UTSW 16 62,720,692 (GRCm39) missense possibly damaging 0.86
R4556:Pros1 UTSW 16 62,721,036 (GRCm39) missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62,709,370 (GRCm39) critical splice donor site probably null
R4850:Pros1 UTSW 16 62,705,887 (GRCm39) missense probably damaging 0.98
R4923:Pros1 UTSW 16 62,723,935 (GRCm39) missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62,748,548 (GRCm39) missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62,734,339 (GRCm39) missense probably benign 0.01
R5580:Pros1 UTSW 16 62,746,689 (GRCm39) critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62,748,424 (GRCm39) missense probably damaging 0.96
R5974:Pros1 UTSW 16 62,721,030 (GRCm39) missense probably damaging 0.98
R6233:Pros1 UTSW 16 62,719,284 (GRCm39) missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62,744,938 (GRCm39) missense probably benign 0.01
R7055:Pros1 UTSW 16 62,748,465 (GRCm39) missense possibly damaging 0.85
R7347:Pros1 UTSW 16 62,739,886 (GRCm39) missense probably damaging 0.97
R7375:Pros1 UTSW 16 62,744,913 (GRCm39) missense probably damaging 0.96
R7419:Pros1 UTSW 16 62,748,433 (GRCm39) nonsense probably null
R7980:Pros1 UTSW 16 62,748,516 (GRCm39) missense possibly damaging 0.86
R8234:Pros1 UTSW 16 62,748,540 (GRCm39) missense possibly damaging 0.73
R8479:Pros1 UTSW 16 62,728,102 (GRCm39) missense probably damaging 1.00
R8514:Pros1 UTSW 16 62,730,472 (GRCm39) missense probably benign 0.03
R8827:Pros1 UTSW 16 62,746,827 (GRCm39) missense probably benign 0.13
R9131:Pros1 UTSW 16 62,748,397 (GRCm39) missense probably damaging 0.96
R9484:Pros1 UTSW 16 62,744,887 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGCCAAGCTGCTTTTACTTGC -3'
(R):5'- TTCCTCGTGGACATAGAGGC -3'

Sequencing Primer
(F):5'- TTCTGTAAGCCCGGCTGG -3'
(R):5'- CTCGTGGACATAGAGGCACATTTC -3'
Posted On 2015-04-30