Incidental Mutation 'R0388:Efcab3'
ID 31428
Institutional Source Beutler Lab
Gene Symbol Efcab3
Ensembl Gene ENSMUSG00000020690
Gene Name EF-hand calcium binding domain 3
Synonyms
MMRRC Submission 038594-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0388 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 105063592-105117537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105109401 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 272 (D272G)
Ref Sequence ENSEMBL: ENSMUSP00000021029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021029] [ENSMUST00000137086] [ENSMUST00000212287]
AlphaFold Q80X60
Predicted Effect possibly damaging
Transcript: ENSMUST00000021029
AA Change: D272G

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021029
Gene: ENSMUSG00000020690
AA Change: D272G

DomainStartEndE-ValueType
Pfam:EF-hand_8 61 113 1e-10 PFAM
low complexity region 394 417 N/A INTRINSIC
low complexity region 420 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137086
SMART Domains Protein: ENSMUSP00000114580
Gene: ENSMUSG00000020690

DomainStartEndE-ValueType
internal_repeat_1 4 78 5.46e-7 PROSPERO
EFh 102 130 2.18e1 SMART
EFh 155 183 4.93e0 SMART
Blast:EFh 257 285 3e-7 BLAST
EFh 293 321 1.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154543
Predicted Effect probably benign
Transcript: ENSMUST00000212287
AA Change: D5648G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
Meta Mutation Damage Score 0.1144 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Efcab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4812001:Efcab3 UTSW 11 105099979 missense probably null 0.00
R1440:Efcab3 UTSW 11 105108755 splice site probably benign
R1540:Efcab3 UTSW 11 105108900 missense probably benign 0.07
R2029:Efcab3 UTSW 11 105100025 missense probably damaging 0.99
R2401:Efcab3 UTSW 11 105072318 critical splice donor site probably null
R3901:Efcab3 UTSW 11 105083887 missense possibly damaging 0.68
R4244:Efcab3 UTSW 11 105111803 missense probably damaging 1.00
R4895:Efcab3 UTSW 11 105117401 unclassified probably benign
R5316:Efcab3 UTSW 11 105076460 missense possibly damaging 0.80
R6378:Efcab3 UTSW 11 105108794 missense possibly damaging 0.83
R6494:Efcab3 UTSW 11 105100019 missense possibly damaging 0.93
R6573:Efcab3 UTSW 11 105080635 missense possibly damaging 0.91
R6723:Efcab3 UTSW 11 105117080 missense possibly damaging 0.95
R7189:Efcab3 UTSW 11 105095864 missense probably benign
R7483:Efcab3 UTSW 11 105109286 missense probably benign 0.39
R7612:Efcab3 UTSW 11 105108821 missense possibly damaging 0.80
R7719:Efcab3 UTSW 11 105111848 missense probably benign 0.14
R7735:Efcab3 UTSW 11 105071639 missense probably benign
R7895:Efcab3 UTSW 11 105117324 missense probably benign 0.29
R8061:Efcab3 UTSW 11 105106449 missense probably benign 0.00
R8116:Efcab3 UTSW 11 105111851 missense possibly damaging 0.65
X0026:Efcab3 UTSW 11 105117111 missense probably benign 0.03
Z1176:Efcab3 UTSW 11 105100046 missense probably damaging 1.00
Z1176:Efcab3 UTSW 11 105108772 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGCCCTCAGACATGGGTGAA -3'
(R):5'- GCCCCAATCCCAAATGTAGGCTTTT -3'

Sequencing Primer
(F):5'- TGAGAGAACGTTAGGCTCTGC -3'
(R):5'- gtcaaagtccttgttggctac -3'
Posted On 2013-04-24