Incidental Mutation 'R0388:Efcab3'
ID 31428
Institutional Source Beutler Lab
Gene Symbol Efcab3
Ensembl Gene ENSMUSG00000020690
Gene Name EF-hand calcium binding domain 3
Synonyms Gm11639, Efcab13, 4921510J17Rik, Efcab15, Gm11639
MMRRC Submission 038594-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0388 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 104954418-105008363 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105000227 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 272 (D272G)
Ref Sequence ENSEMBL: ENSMUSP00000021029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021029] [ENSMUST00000137086] [ENSMUST00000212287]
AlphaFold Q80X60
Predicted Effect possibly damaging
Transcript: ENSMUST00000021029
AA Change: D272G

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021029
Gene: ENSMUSG00000020690
AA Change: D272G

DomainStartEndE-ValueType
Pfam:EF-hand_8 61 113 1e-10 PFAM
low complexity region 394 417 N/A INTRINSIC
low complexity region 420 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137086
SMART Domains Protein: ENSMUSP00000114580
Gene: ENSMUSG00000020690

DomainStartEndE-ValueType
internal_repeat_1 4 78 5.46e-7 PROSPERO
EFh 102 130 2.18e1 SMART
EFh 155 183 4.93e0 SMART
Blast:EFh 257 285 3e-7 BLAST
EFh 293 321 1.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154543
Predicted Effect probably benign
Transcript: ENSMUST00000212287
AA Change: D5648G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
Meta Mutation Damage Score 0.1144 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
Acsbg1 T C 9: 54,516,347 (GRCm39) K678R probably damaging Het
Adgrg6 A G 10: 14,326,402 (GRCm39) I410T probably benign Het
Afap1l2 A C 19: 56,905,674 (GRCm39) probably benign Het
Aox1 T C 1: 58,393,565 (GRCm39) Y1242H probably damaging Het
Apoo-ps T C 13: 107,551,173 (GRCm39) noncoding transcript Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Cdh3 C A 8: 107,265,761 (GRCm39) T268K probably damaging Het
Chd5 T A 4: 152,456,101 (GRCm39) H923Q probably damaging Het
Chd7 T C 4: 8,854,560 (GRCm39) V1967A probably benign Het
Cntn3 T C 6: 102,254,277 (GRCm39) M222V probably damaging Het
Dcaf17 A G 2: 70,908,915 (GRCm39) K277R probably benign Het
Dmbt1 T C 7: 130,697,779 (GRCm39) probably benign Het
Dmpk T A 7: 18,818,002 (GRCm39) probably benign Het
Dzank1 A T 2: 144,318,026 (GRCm39) L714Q possibly damaging Het
Erbb2 G C 11: 98,318,177 (GRCm39) R471P possibly damaging Het
Esf1 T A 2: 139,962,791 (GRCm39) Y760F possibly damaging Het
Fanci C A 7: 79,089,378 (GRCm39) T938K probably benign Het
Gnai3 A G 3: 108,023,073 (GRCm39) probably benign Het
Hspg2 T A 4: 137,238,469 (GRCm39) C319S probably damaging Het
Il12a T A 3: 68,602,520 (GRCm39) probably null Het
Inpp4a A G 1: 37,435,241 (GRCm39) D837G probably damaging Het
Kcnj5 T A 9: 32,229,159 (GRCm39) E13V probably damaging Het
Kcnq3 T A 15: 65,871,887 (GRCm39) Y594F probably benign Het
Kif16b T C 2: 142,582,857 (GRCm39) E556G probably damaging Het
Kif28 T C 1: 179,567,654 (GRCm39) I39V possibly damaging Het
Lgi2 T C 5: 52,711,891 (GRCm39) E143G probably damaging Het
Mast1 T G 8: 85,642,166 (GRCm39) I1063L probably benign Het
Med12l T C 3: 59,000,925 (GRCm39) probably benign Het
Mmp19 G T 10: 128,634,752 (GRCm39) R456L probably benign Het
Mon1b T A 8: 114,365,710 (GRCm39) V346E probably damaging Het
Mpv17l A T 16: 13,758,863 (GRCm39) I96L probably benign Het
Mrgpra9 A T 7: 46,902,542 (GRCm39) M1K probably null Het
Mycbp2 A T 14: 103,394,103 (GRCm39) H2819Q probably benign Het
Nav1 A C 1: 135,376,655 (GRCm39) probably benign Het
Neurl4 T C 11: 69,802,559 (GRCm39) probably benign Het
Ntng2 G C 2: 29,097,438 (GRCm39) P341R probably damaging Het
Oas1d A T 5: 121,055,091 (GRCm39) Y221F probably damaging Het
Or1j19 C A 2: 36,676,874 (GRCm39) D112E probably benign Het
Or1l4 A C 2: 37,092,196 (GRCm39) probably null Het
Or5al6 A G 2: 85,976,974 (GRCm39) Y35H probably damaging Het
Osbpl8 A G 10: 111,108,143 (GRCm39) M380V probably benign Het
Pank1 T C 19: 34,799,106 (GRCm39) probably benign Het
Parn T C 16: 13,472,340 (GRCm39) D169G possibly damaging Het
Pknox1 T A 17: 31,822,166 (GRCm39) I311N probably damaging Het
Pprc1 T C 19: 46,051,214 (GRCm39) V248A possibly damaging Het
Prkcq T C 2: 11,259,045 (GRCm39) C322R probably benign Het
Ptpn13 T A 5: 103,702,928 (GRCm39) I1298N probably benign Het
Rab11fip3 A G 17: 26,288,046 (GRCm39) S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Sass6 C A 3: 116,400,957 (GRCm39) probably benign Het
Shroom3 G A 5: 93,099,152 (GRCm39) G1463D probably benign Het
Slc35d1 A T 4: 103,042,084 (GRCm39) Y249* probably null Het
Slc9a3 C T 13: 74,269,655 (GRCm39) P8S unknown Het
Slc9a9 T A 9: 94,821,616 (GRCm39) probably null Het
Sting1 A G 18: 35,868,164 (GRCm39) probably null Het
Syne2 T A 12: 76,033,749 (GRCm39) M3666K probably benign Het
Synpo2 A G 3: 122,873,546 (GRCm39) V1140A probably benign Het
Thada A G 17: 84,538,524 (GRCm39) F1495L probably benign Het
Timeless A G 10: 128,077,294 (GRCm39) probably null Het
Tlr6 G T 5: 65,112,548 (GRCm39) H120N possibly damaging Het
Tns3 T C 11: 8,395,703 (GRCm39) I1234V probably benign Het
Ttll9 A G 2: 152,842,099 (GRCm39) S318G probably benign Het
Vps13c T C 9: 67,830,197 (GRCm39) probably benign Het
Zfp933 T C 4: 147,910,899 (GRCm39) I232M probably benign Het
Zfyve27 T C 19: 42,178,024 (GRCm39) S382P probably damaging Het
Other mutations in Efcab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Efcab3 APN 11 104,990,847 (GRCm39) missense probably damaging 1.00
IGL01308:Efcab3 APN 11 104,611,523 (GRCm39) missense probably benign 0.03
IGL01483:Efcab3 APN 11 104,630,173 (GRCm39) missense probably benign 0.03
IGL01695:Efcab3 APN 11 104,626,889 (GRCm39) missense probably damaging 1.00
IGL01860:Efcab3 APN 11 104,581,747 (GRCm39) missense probably benign 0.16
IGL01981:Efcab3 APN 11 104,612,258 (GRCm39) intron probably benign
IGL01984:Efcab3 APN 11 104,629,134 (GRCm39) missense probably benign 0.20
IGL02023:Efcab3 APN 11 104,612,258 (GRCm39) intron probably benign
IGL02252:Efcab3 APN 11 104,644,753 (GRCm39) missense possibly damaging 0.68
IGL02886:Efcab3 APN 11 104,986,700 (GRCm39) missense possibly damaging 0.95
IGL03116:Efcab3 APN 11 104,612,359 (GRCm39) missense probably benign 0.02
IGL03141:Efcab3 APN 11 104,986,696 (GRCm39) missense probably damaging 0.99
IGL03242:Efcab3 APN 11 104,997,230 (GRCm39) missense probably damaging 1.00
IGL03274:Efcab3 APN 11 104,611,919 (GRCm39) missense probably benign 0.03
IGL03408:Efcab3 APN 11 104,601,447 (GRCm39) missense probably benign 0.03
PIT4812001:Efcab3 UTSW 11 104,990,805 (GRCm39) missense probably null 0.00
R0018:Efcab3 UTSW 11 104,612,378 (GRCm39) critical splice donor site probably null
R0068:Efcab3 UTSW 11 104,611,648 (GRCm39) missense probably benign 0.29
R0350:Efcab3 UTSW 11 104,581,706 (GRCm39) missense probably benign 0.03
R0646:Efcab3 UTSW 11 104,611,327 (GRCm39) missense probably benign 0.03
R0668:Efcab3 UTSW 11 104,611,318 (GRCm39) missense probably benign 0.16
R0715:Efcab3 UTSW 11 104,611,706 (GRCm39) missense possibly damaging 0.90
R0944:Efcab3 UTSW 11 104,601,556 (GRCm39) splice site probably null
R1330:Efcab3 UTSW 11 104,637,116 (GRCm39) missense possibly damaging 0.84
R1440:Efcab3 UTSW 11 104,999,581 (GRCm39) splice site probably benign
R1508:Efcab3 UTSW 11 104,601,503 (GRCm39) missense probably benign 0.03
R1540:Efcab3 UTSW 11 104,999,726 (GRCm39) missense probably benign 0.07
R1643:Efcab3 UTSW 11 104,589,804 (GRCm39) missense probably benign 0.16
R1651:Efcab3 UTSW 11 104,611,492 (GRCm39) missense probably benign 0.03
R1665:Efcab3 UTSW 11 104,611,940 (GRCm39) missense probably benign 0.07
R1702:Efcab3 UTSW 11 104,581,832 (GRCm39) missense probably benign 0.03
R1711:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1779:Efcab3 UTSW 11 104,611,765 (GRCm39) missense probably benign 0.15
R1813:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1818:Efcab3 UTSW 11 104,612,333 (GRCm39) missense probably benign 0.10
R1896:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1969:Efcab3 UTSW 11 104,637,090 (GRCm39) missense probably damaging 1.00
R2029:Efcab3 UTSW 11 104,990,851 (GRCm39) missense probably damaging 0.99
R2139:Efcab3 UTSW 11 104,642,737 (GRCm39) missense possibly damaging 0.53
R2165:Efcab3 UTSW 11 104,642,688 (GRCm39) missense possibly damaging 0.93
R2359:Efcab3 UTSW 11 104,630,106 (GRCm39) missense possibly damaging 0.80
R2394:Efcab3 UTSW 11 104,629,121 (GRCm39) missense probably benign 0.17
R2401:Efcab3 UTSW 11 104,963,144 (GRCm39) critical splice donor site probably null
R2406:Efcab3 UTSW 11 104,611,457 (GRCm39) missense probably benign 0.03
R2570:Efcab3 UTSW 11 104,624,490 (GRCm39) missense probably damaging 1.00
R3795:Efcab3 UTSW 11 104,624,501 (GRCm39) missense possibly damaging 0.94
R3901:Efcab3 UTSW 11 104,974,713 (GRCm39) missense possibly damaging 0.68
R4244:Efcab3 UTSW 11 105,002,629 (GRCm39) missense probably damaging 1.00
R4352:Efcab3 UTSW 11 104,630,140 (GRCm39) missense probably null 0.25
R4359:Efcab3 UTSW 11 104,624,547 (GRCm39) splice site probably null
R4424:Efcab3 UTSW 11 104,626,940 (GRCm39) critical splice donor site probably null
R4895:Efcab3 UTSW 11 104,611,112 (GRCm39) missense probably benign 0.16
R4895:Efcab3 UTSW 11 105,008,227 (GRCm39) unclassified probably benign
R4895:Efcab3 UTSW 11 104,640,496 (GRCm39) missense probably damaging 1.00
R5006:Efcab3 UTSW 11 104,620,503 (GRCm39) splice site probably null
R5066:Efcab3 UTSW 11 104,611,490 (GRCm39) missense probably benign 0.03
R5316:Efcab3 UTSW 11 104,967,286 (GRCm39) missense possibly damaging 0.80
R5329:Efcab3 UTSW 11 104,644,632 (GRCm39) splice site probably null
R5405:Efcab3 UTSW 11 104,612,018 (GRCm39) missense probably benign 0.07
R5814:Efcab3 UTSW 11 104,626,940 (GRCm39) critical splice donor site probably benign
R5888:Efcab3 UTSW 11 104,612,227 (GRCm39) splice site probably benign
R5910:Efcab3 UTSW 11 104,581,760 (GRCm39) missense probably benign 0.01
R5975:Efcab3 UTSW 11 104,578,375 (GRCm39) start gained probably benign
R6019:Efcab3 UTSW 11 104,933,728 (GRCm39) critical splice donor site probably null
R6028:Efcab3 UTSW 11 104,660,481 (GRCm39) critical splice donor site probably null
R6048:Efcab3 UTSW 11 104,835,259 (GRCm39) missense unknown
R6059:Efcab3 UTSW 11 104,927,595 (GRCm39) missense probably benign 0.03
R6147:Efcab3 UTSW 11 104,858,566 (GRCm39) missense unknown
R6176:Efcab3 UTSW 11 104,683,383 (GRCm39) missense probably benign 0.16
R6181:Efcab3 UTSW 11 104,722,159 (GRCm39) missense probably benign 0.25
R6196:Efcab3 UTSW 11 104,746,386 (GRCm39) missense probably benign 0.07
R6245:Efcab3 UTSW 11 104,675,834 (GRCm39) missense probably benign 0.03
R6262:Efcab3 UTSW 11 104,784,579 (GRCm39) missense probably benign 0.24
R6263:Efcab3 UTSW 11 104,810,312 (GRCm39) missense unknown
R6277:Efcab3 UTSW 11 104,901,148 (GRCm39) missense possibly damaging 0.49
R6338:Efcab3 UTSW 11 104,734,034 (GRCm39) nonsense probably null
R6355:Efcab3 UTSW 11 104,896,511 (GRCm39) missense probably benign 0.29
R6356:Efcab3 UTSW 11 104,784,533 (GRCm39) missense probably benign 0.19
R6365:Efcab3 UTSW 11 104,815,412 (GRCm39) missense unknown
R6378:Efcab3 UTSW 11 104,999,620 (GRCm39) missense possibly damaging 0.83
R6391:Efcab3 UTSW 11 104,885,143 (GRCm39) missense possibly damaging 0.92
R6494:Efcab3 UTSW 11 104,990,845 (GRCm39) missense possibly damaging 0.93
R6556:Efcab3 UTSW 11 104,899,077 (GRCm39) missense probably null 0.03
R6573:Efcab3 UTSW 11 104,971,461 (GRCm39) missense possibly damaging 0.91
R6604:Efcab3 UTSW 11 104,589,772 (GRCm39) nonsense probably null
R6605:Efcab3 UTSW 11 104,890,107 (GRCm39) splice site probably null
R6634:Efcab3 UTSW 11 104,784,609 (GRCm39) missense probably benign 0.17
R6723:Efcab3 UTSW 11 105,007,906 (GRCm39) missense possibly damaging 0.95
R6851:Efcab3 UTSW 11 104,896,521 (GRCm39) missense probably benign 0.03
R6862:Efcab3 UTSW 11 104,612,284 (GRCm39) nonsense probably null
R6949:Efcab3 UTSW 11 104,799,896 (GRCm39) missense probably damaging 1.00
R6970:Efcab3 UTSW 11 104,667,182 (GRCm39) missense probably benign 0.03
R7014:Efcab3 UTSW 11 104,584,248 (GRCm39) missense probably benign 0.03
R7097:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R7122:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R7124:Efcab3 UTSW 11 104,629,100 (GRCm39) missense probably benign 0.17
R7146:Efcab3 UTSW 11 104,913,764 (GRCm39) missense probably benign 0.03
R7146:Efcab3 UTSW 11 104,858,578 (GRCm39) missense unknown
R7154:Efcab3 UTSW 11 104,589,966 (GRCm39) splice site probably null
R7175:Efcab3 UTSW 11 104,838,237 (GRCm39) missense unknown
R7189:Efcab3 UTSW 11 104,986,690 (GRCm39) missense probably benign
R7198:Efcab3 UTSW 11 104,642,711 (GRCm39) missense probably benign 0.15
R7211:Efcab3 UTSW 11 104,615,435 (GRCm39) critical splice donor site probably null
R7211:Efcab3 UTSW 11 104,601,539 (GRCm39) missense probably benign 0.01
R7216:Efcab3 UTSW 11 104,771,375 (GRCm39) missense possibly damaging 0.49
R7221:Efcab3 UTSW 11 104,791,432 (GRCm39) missense probably benign 0.36
R7233:Efcab3 UTSW 11 104,730,669 (GRCm39) missense possibly damaging 0.69
R7236:Efcab3 UTSW 11 104,790,093 (GRCm39) missense probably benign 0.10
R7262:Efcab3 UTSW 11 104,745,432 (GRCm39) critical splice donor site probably null
R7289:Efcab3 UTSW 11 104,929,184 (GRCm39) missense probably benign 0.24
R7323:Efcab3 UTSW 11 104,920,837 (GRCm39) missense probably benign 0.07
R7378:Efcab3 UTSW 11 104,605,528 (GRCm39) missense probably benign 0.03
R7388:Efcab3 UTSW 11 104,611,871 (GRCm39) missense probably damaging 0.97
R7390:Efcab3 UTSW 11 104,615,411 (GRCm39) missense possibly damaging 0.46
R7411:Efcab3 UTSW 11 104,890,549 (GRCm39) missense probably benign 0.10
R7468:Efcab3 UTSW 11 104,640,526 (GRCm39) missense probably benign 0.17
R7483:Efcab3 UTSW 11 105,000,112 (GRCm39) missense probably benign 0.39
R7497:Efcab3 UTSW 11 104,653,516 (GRCm39) critical splice donor site probably null
R7612:Efcab3 UTSW 11 104,999,647 (GRCm39) missense possibly damaging 0.80
R7620:Efcab3 UTSW 11 104,722,969 (GRCm39) missense possibly damaging 0.95
R7638:Efcab3 UTSW 11 104,927,625 (GRCm39) missense probably benign 0.03
R7661:Efcab3 UTSW 11 104,617,503 (GRCm39) missense probably benign 0.03
R7667:Efcab3 UTSW 11 104,642,737 (GRCm39) missense possibly damaging 0.53
R7682:Efcab3 UTSW 11 104,855,174 (GRCm39) splice site probably null
R7708:Efcab3 UTSW 11 104,855,397 (GRCm39) missense unknown
R7719:Efcab3 UTSW 11 105,002,674 (GRCm39) missense probably benign 0.14
R7721:Efcab3 UTSW 11 104,615,366 (GRCm39) nonsense probably null
R7735:Efcab3 UTSW 11 104,962,465 (GRCm39) missense probably benign
R7747:Efcab3 UTSW 11 104,733,429 (GRCm39) missense probably damaging 0.96
R7840:Efcab3 UTSW 11 104,624,539 (GRCm39) missense probably benign 0.07
R7846:Efcab3 UTSW 11 104,605,571 (GRCm39) critical splice donor site probably null
R7893:Efcab3 UTSW 11 104,870,186 (GRCm39) missense unknown
R7895:Efcab3 UTSW 11 105,008,150 (GRCm39) missense probably benign 0.29
R7897:Efcab3 UTSW 11 104,889,061 (GRCm39) missense probably benign 0.24
R7936:Efcab3 UTSW 11 104,890,524 (GRCm39) missense possibly damaging 0.89
R7936:Efcab3 UTSW 11 104,937,385 (GRCm39) critical splice donor site probably null
R7959:Efcab3 UTSW 11 104,933,627 (GRCm39) missense probably damaging 0.96
R8031:Efcab3 UTSW 11 104,772,295 (GRCm39) missense possibly damaging 0.49
R8041:Efcab3 UTSW 11 104,810,305 (GRCm39) missense unknown
R8054:Efcab3 UTSW 11 104,621,226 (GRCm39) missense probably benign 0.07
R8056:Efcab3 UTSW 11 104,799,896 (GRCm39) missense probably damaging 0.98
R8061:Efcab3 UTSW 11 104,997,275 (GRCm39) missense probably benign 0.00
R8088:Efcab3 UTSW 11 104,889,072 (GRCm39) missense probably benign 0.10
R8112:Efcab3 UTSW 11 104,841,026 (GRCm39) missense unknown
R8116:Efcab3 UTSW 11 105,002,677 (GRCm39) missense possibly damaging 0.65
R8340:Efcab3 UTSW 11 104,876,856 (GRCm39) missense unknown
R8405:Efcab3 UTSW 11 104,612,024 (GRCm39) missense probably benign 0.02
R8413:Efcab3 UTSW 11 104,811,135 (GRCm39) missense unknown
R8472:Efcab3 UTSW 11 104,709,463 (GRCm39) missense probably benign 0.07
R8549:Efcab3 UTSW 11 104,890,521 (GRCm39) missense probably damaging 0.99
R8699:Efcab3 UTSW 11 104,672,072 (GRCm39) missense probably benign 0.03
R8711:Efcab3 UTSW 11 104,743,371 (GRCm39) missense probably benign 0.03
R8732:Efcab3 UTSW 11 104,695,100 (GRCm39) missense probably benign 0.03
R8745:Efcab3 UTSW 11 104,749,304 (GRCm39) missense possibly damaging 0.57
R8806:Efcab3 UTSW 11 104,928,695 (GRCm39) missense probably benign 0.07
R8810:Efcab3 UTSW 11 104,805,721 (GRCm39) missense unknown
R8845:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R8870:Efcab3 UTSW 11 104,791,500 (GRCm39) missense probably benign 0.07
R8872:Efcab3 UTSW 11 104,760,880 (GRCm39) missense probably benign 0.19
R8879:Efcab3 UTSW 11 104,581,781 (GRCm39) missense probably benign 0.03
R8924:Efcab3 UTSW 11 104,806,253 (GRCm39) frame shift probably null
R8954:Efcab3 UTSW 11 104,909,525 (GRCm39) critical splice donor site probably null
R8960:Efcab3 UTSW 11 104,820,772 (GRCm39) splice site probably benign
R8975:Efcab3 UTSW 11 104,954,415 (GRCm39) missense probably benign 0.17
R8988:Efcab3 UTSW 11 104,911,352 (GRCm39) missense probably benign 0.07
R8998:Efcab3 UTSW 11 104,640,477 (GRCm39) missense probably benign 0.09
R8999:Efcab3 UTSW 11 104,640,477 (GRCm39) missense probably benign 0.09
R9002:Efcab3 UTSW 11 104,920,822 (GRCm39) missense probably damaging 0.99
R9012:Efcab3 UTSW 11 104,711,347 (GRCm39) critical splice donor site probably null
R9036:Efcab3 UTSW 11 104,927,601 (GRCm39) missense probably benign 0.03
R9037:Efcab3 UTSW 11 104,803,791 (GRCm39) missense unknown
R9059:Efcab3 UTSW 11 104,642,689 (GRCm39) missense possibly damaging 0.73
R9066:Efcab3 UTSW 11 104,631,688 (GRCm39) intron probably benign
R9122:Efcab3 UTSW 11 104,856,605 (GRCm39) missense unknown
R9125:Efcab3 UTSW 11 104,736,360 (GRCm39) missense probably damaging 1.00
R9127:Efcab3 UTSW 11 104,741,407 (GRCm39) missense probably benign 0.07
R9171:Efcab3 UTSW 11 104,800,708 (GRCm39) missense probably benign 0.36
R9219:Efcab3 UTSW 11 104,836,691 (GRCm39) missense unknown
R9224:Efcab3 UTSW 11 104,661,801 (GRCm39) missense probably benign 0.07
R9235:Efcab3 UTSW 11 104,907,987 (GRCm39) missense probably benign 0.19
R9294:Efcab3 UTSW 11 104,722,126 (GRCm39) missense probably benign 0.24
R9318:Efcab3 UTSW 11 104,856,648 (GRCm39) critical splice donor site probably null
R9322:Efcab3 UTSW 11 104,765,199 (GRCm39) missense probably benign 0.36
R9361:Efcab3 UTSW 11 104,896,524 (GRCm39) missense probably benign 0.03
R9408:Efcab3 UTSW 11 104,621,255 (GRCm39) critical splice donor site probably null
R9434:Efcab3 UTSW 11 104,899,863 (GRCm39) missense probably benign 0.24
R9477:Efcab3 UTSW 11 104,836,698 (GRCm39) missense unknown
R9658:Efcab3 UTSW 11 104,611,120 (GRCm39) missense probably benign 0.03
R9719:Efcab3 UTSW 11 104,867,912 (GRCm39) missense unknown
R9751:Efcab3 UTSW 11 104,783,911 (GRCm39) missense probably benign 0.19
R9763:Efcab3 UTSW 11 104,890,485 (GRCm39) missense possibly damaging 0.89
X0026:Efcab3 UTSW 11 105,007,937 (GRCm39) missense probably benign 0.03
X0026:Efcab3 UTSW 11 104,611,801 (GRCm39) missense probably benign 0.07
Z1088:Efcab3 UTSW 11 104,642,728 (GRCm39) missense probably damaging 0.96
Z1176:Efcab3 UTSW 11 104,990,872 (GRCm39) missense probably damaging 1.00
Z1176:Efcab3 UTSW 11 104,892,793 (GRCm39) missense probably benign 0.29
Z1176:Efcab3 UTSW 11 104,999,598 (GRCm39) nonsense probably null
Z1177:Efcab3 UTSW 11 104,711,344 (GRCm39) missense probably benign 0.03
Z1177:Efcab3 UTSW 11 104,630,164 (GRCm39) nonsense probably null
Z1177:Efcab3 UTSW 11 104,814,845 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGAGCCCTCAGACATGGGTGAA -3'
(R):5'- GCCCCAATCCCAAATGTAGGCTTTT -3'

Sequencing Primer
(F):5'- TGAGAGAACGTTAGGCTCTGC -3'
(R):5'- gtcaaagtccttgttggctac -3'
Posted On 2013-04-24