Incidental Mutation 'R0388:Slc9a3'
ID31429
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms9030624O13Rik, NHE-3, NHE3
MMRRC Submission 038594-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0388 (G1)
Quality Score166
Status Validated
Chromosome13
Chromosomal Location74121457-74169442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74121536 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 8 (P8S)
Ref Sequence ENSEMBL: ENSMUSP00000153255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
Predicted Effect unknown
Transcript: ENSMUST00000036208
AA Change: P8S
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: P8S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221410
Predicted Effect unknown
Transcript: ENSMUST00000221703
AA Change: P8S
Predicted Effect unknown
Transcript: ENSMUST00000225423
AA Change: P8S
Meta Mutation Damage Score 0.0966 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74161770 missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74166056 splice site probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74161732 missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4581:Slc9a3 UTSW 13 74164165 missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R5919:Slc9a3 UTSW 13 74158740 missense probably damaging 0.98
R6060:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R6562:Slc9a3 UTSW 13 74155161 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74150678 missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R7565:Slc9a3 UTSW 13 74157694 missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74160276 missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74157644 missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74166027 missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74155122 missense probably damaging 1.00
R8159:Slc9a3 UTSW 13 74164288 missense probably benign 0.01
Z1176:Slc9a3 UTSW 13 74165856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCAGGACTGTTTGCGTTCAC -3'
(R):5'- GCATGGCTAAGGCTCAGTCATAGG -3'

Sequencing Primer
(F):5'- AGCGGGATTAAAGGCCAC -3'
(R):5'- GGATACTTATGATCCACAAAACCTGG -3'
Posted On2013-04-24