Mutagenetix > Incidental Mutation

Incidental Mutation 'R4057:Ints2'

314296

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4057 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 86242952 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 424 (L424R)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000018212
AA Change: L424R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: L424R

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108039
AA Change: L424R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: L424R

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127745

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Meta Mutation Damage Score

0.6968

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

95% (36/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,219,025	M1686K	probably benign	Het
Abcf1	A	G	17: 35,959,915	I510T	possibly damaging	Het
Asb2	A	G	12: 103,325,394	Y377H	probably benign	Het
Cars	T	C	7: 143,570,648	E347G	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dst	T	C	1: 34,186,054		probably benign	Het
Emcn	C	A	3: 137,379,899	T86K	probably damaging	Het
Fcgbp	A	T	7: 28,104,116	Q1715L	probably benign	Het
Hmcn2	A	G	2: 31,400,238	Y2361C	probably damaging	Het
Hpse2	T	C	19: 43,294,275	K180E	probably damaging	Het
Kalrn	A	T	16: 34,314,209	I401N	probably damaging	Het
Ltbp1	G	T	17: 75,310,194	G725C	probably damaging	Het
Maats1	A	G	16: 38,298,214	V741A	probably benign	Het
Myo3a	T	A	2: 22,266,160	M144K	probably benign	Het
Nav3	A	T	10: 109,880,533		probably null	Het
Neb	A	T	2: 52,206,699	V5000D	possibly damaging	Het
Neb	G	T	2: 52,237,108	A3534E	probably benign	Het
Nlrp9a	T	A	7: 26,570,646	C833S	probably benign	Het
Npas1	C	A	7: 16,474,787	R55L	probably damaging	Het
Olfr659	A	G	7: 104,671,269	K189R	probably damaging	Het
P2ry10	T	C	X: 107,103,256	C266R	probably damaging	Het
Pcdh1	T	C	18: 38,198,897	E351G	probably damaging	Het
Plce1	A	T	19: 38,760,119	R1751W	probably damaging	Het
Plekhn1	T	C	4: 156,224,693		probably null	Het
Por	A	G	5: 135,731,574	Y245C	probably damaging	Het
Ptprm	A	C	17: 67,075,663	I158S	possibly damaging	Het
Rsf1	GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC	GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC	7: 97,579,906		probably benign	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Sbf2	T	C	7: 110,441,466	I385V	probably damaging	Het
Serpina3m	A	C	12: 104,391,737		probably benign	Het
Sox5	G	T	6: 144,116,522	R135S	probably damaging	Het
Stag2	A	G	X: 42,224,942	T228A	probably damaging	Het
Wif1	G	A	10: 121,082,194	V156I	probably benign	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACACCCTTATTGGTAGTAACACTC -3'
(R):5'- TGTGTGCTACTCACCTGCAG -3'

Sequencing Primer
(F):5'- GGTAGTAACACTCCTTCTAGGCG -3'
(R):5'- CAGTGCGGTTAAAAAGTTTGC -3'

Posted On

2015-04-30