Incidental Mutation 'R4057:Asb2'
ID314298
Institutional Source Beutler Lab
Gene Symbol Asb2
Ensembl Gene ENSMUSG00000021200
Gene Nameankyrin repeat and SOCS box-containing 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4057 (G1)
Quality Score208
Status Validated
Chromosome12
Chromosomal Location103321142-103356001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103325394 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 377 (Y377H)
Ref Sequence ENSEMBL: ENSMUSP00000117595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021617] [ENSMUST00000149431]
Predicted Effect probably benign
Transcript: ENSMUST00000021617
AA Change: Y425H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021617
Gene: ENSMUSG00000021200
AA Change: Y425H

DomainStartEndE-ValueType
UIM 26 45 1.02e0 SMART
ANK 104 133 1.81e2 SMART
ANK 137 167 5.45e-2 SMART
ANK 171 200 5.45e-2 SMART
ANK 204 233 2.21e-2 SMART
ANK 237 266 9.13e-4 SMART
ANK 270 299 7.42e-4 SMART
ANK 303 332 1.19e-2 SMART
ANK 336 365 5.67e0 SMART
ANK 368 397 6.02e-4 SMART
ANK 410 439 3.54e-1 SMART
ANK 440 469 6.81e-3 SMART
SOCS_box 592 631 2.51e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127447
Predicted Effect probably benign
Transcript: ENSMUST00000149431
AA Change: Y377H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117595
Gene: ENSMUSG00000021200
AA Change: Y377H

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
ANK 56 85 1.81e2 SMART
ANK 89 119 5.45e-2 SMART
ANK 123 152 5.45e-2 SMART
ANK 156 185 2.21e-2 SMART
ANK 189 218 9.13e-4 SMART
ANK 222 251 7.42e-4 SMART
ANK 255 284 1.19e-2 SMART
ANK 288 317 5.67e0 SMART
ANK 320 349 6.02e-4 SMART
ANK 362 391 3.54e-1 SMART
ANK 392 421 6.81e-3 SMART
SOCS_box 544 583 2.51e-11 SMART
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ankyrin repeat and SOCS box-containing (ASB) protein family. These proteins play a role in protein degradation by coupling suppressor of cytokine signalling (SOCS) proteins with the elongin BC complex. The encoded protein is a subunit of a multimeric E3 ubiquitin ligase complex that mediates the degradation of actin-binding proteins. This gene plays a role in retinoic acid-induced growth inhibition and differentiation of myeloid leukemia cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a conditional cells activated in the immune system exhibit impaired immature dendritic cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,025 M1686K probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Cars T C 7: 143,570,648 E347G probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst T C 1: 34,186,054 probably benign Het
Emcn C A 3: 137,379,899 T86K probably damaging Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Hmcn2 A G 2: 31,400,238 Y2361C probably damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Ltbp1 G T 17: 75,310,194 G725C probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Myo3a T A 2: 22,266,160 M144K probably benign Het
Nav3 A T 10: 109,880,533 probably null Het
Neb A T 2: 52,206,699 V5000D possibly damaging Het
Neb G T 2: 52,237,108 A3534E probably benign Het
Nlrp9a T A 7: 26,570,646 C833S probably benign Het
Npas1 C A 7: 16,474,787 R55L probably damaging Het
Olfr659 A G 7: 104,671,269 K189R probably damaging Het
P2ry10 T C X: 107,103,256 C266R probably damaging Het
Pcdh1 T C 18: 38,198,897 E351G probably damaging Het
Plce1 A T 19: 38,760,119 R1751W probably damaging Het
Plekhn1 T C 4: 156,224,693 probably null Het
Por A G 5: 135,731,574 Y245C probably damaging Het
Ptprm A C 17: 67,075,663 I158S possibly damaging Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Serpina3m A C 12: 104,391,737 probably benign Het
Sox5 G T 6: 144,116,522 R135S probably damaging Het
Stag2 A G X: 42,224,942 T228A probably damaging Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Other mutations in Asb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Asb2 APN 12 103335905 missense possibly damaging 0.93
IGL01878:Asb2 APN 12 103321663 missense possibly damaging 0.89
IGL02103:Asb2 APN 12 103333496 nonsense probably null
IGL02936:Asb2 APN 12 103335914 missense probably benign 0.04
R0178:Asb2 UTSW 12 103325552 missense probably damaging 1.00
R0208:Asb2 UTSW 12 103325271 missense possibly damaging 0.77
R0844:Asb2 UTSW 12 103325546 missense probably damaging 1.00
R1309:Asb2 UTSW 12 103325408 missense probably benign
R2931:Asb2 UTSW 12 103334887 missense probably damaging 1.00
R4735:Asb2 UTSW 12 103325058 missense probably benign 0.43
R4754:Asb2 UTSW 12 103323837 missense possibly damaging 0.95
R5916:Asb2 UTSW 12 103323876 missense probably damaging 1.00
R5946:Asb2 UTSW 12 103321555 missense probably benign 0.00
R6349:Asb2 UTSW 12 103345859 start codon destroyed probably null 0.07
R6605:Asb2 UTSW 12 103345684 missense probably benign 0.02
R7317:Asb2 UTSW 12 103333357 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCAAACATGATGGTGGC -3'
(R):5'- CTTACAGAATAGTGCAGATGCTG -3'

Sequencing Primer
(F):5'- CATGATGGTGGCTGGAAAGGC -3'
(R):5'- AGATGCTGCTGCCTGTGAC -3'
Posted On2015-04-30