Incidental Mutation 'R4057:Serpina3m'
ID314299
Institutional Source Beutler Lab
Gene Symbol Serpina3m
Ensembl Gene ENSMUSG00000079012
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3M
Synonymsantitrypsin, Spi2.4, alpha-1 antiproteinase, MMSPi2.4, contrapsin-like, Spi-2l, Spi-2rs1, 3e46, MMCM7, Spi2-rs1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4057 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104338486-104394257 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 104391737 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101078] [ENSMUST00000168797]
Predicted Effect probably benign
Transcript: ENSMUST00000101078
SMART Domains Protein: ENSMUSP00000098639
Gene: ENSMUSG00000079012

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 3.12e-199 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168797
SMART Domains Protein: ENSMUSP00000130979
Gene: ENSMUSG00000079012

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 3.12e-199 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,025 M1686K probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Asb2 A G 12: 103,325,394 Y377H probably benign Het
Cars T C 7: 143,570,648 E347G probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst T C 1: 34,186,054 probably benign Het
Emcn C A 3: 137,379,899 T86K probably damaging Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Hmcn2 A G 2: 31,400,238 Y2361C probably damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Ltbp1 G T 17: 75,310,194 G725C probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Myo3a T A 2: 22,266,160 M144K probably benign Het
Nav3 A T 10: 109,880,533 probably null Het
Neb A T 2: 52,206,699 V5000D possibly damaging Het
Neb G T 2: 52,237,108 A3534E probably benign Het
Nlrp9a T A 7: 26,570,646 C833S probably benign Het
Npas1 C A 7: 16,474,787 R55L probably damaging Het
Olfr659 A G 7: 104,671,269 K189R probably damaging Het
P2ry10 T C X: 107,103,256 C266R probably damaging Het
Pcdh1 T C 18: 38,198,897 E351G probably damaging Het
Plce1 A T 19: 38,760,119 R1751W probably damaging Het
Plekhn1 T C 4: 156,224,693 probably null Het
Por A G 5: 135,731,574 Y245C probably damaging Het
Ptprm A C 17: 67,075,663 I158S possibly damaging Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Sox5 G T 6: 144,116,522 R135S probably damaging Het
Stag2 A G X: 42,224,942 T228A probably damaging Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Other mutations in Serpina3m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4976:Serpina3m UTSW 12 104358623 intron probably null
R1797:Serpina3m UTSW 12 104389515 missense probably damaging 1.00
R1929:Serpina3m UTSW 12 104389322 missense probably damaging 0.97
R1991:Serpina3m UTSW 12 104389699 nonsense probably null
R2032:Serpina3m UTSW 12 104389669 missense probably benign 0.00
R2094:Serpina3m UTSW 12 104389270 missense probably benign 0.35
R2103:Serpina3m UTSW 12 104389699 nonsense probably null
R2121:Serpina3m UTSW 12 104389682 missense possibly damaging 0.59
R2147:Serpina3m UTSW 12 104389224 missense probably benign 0.01
R2241:Serpina3m UTSW 12 104389449 missense probably benign 0.01
R2330:Serpina3m UTSW 12 104391704 missense possibly damaging 0.61
R4275:Serpina3m UTSW 12 104389116 missense probably damaging 0.99
R4466:Serpina3m UTSW 12 104391615 missense probably damaging 1.00
R4901:Serpina3m UTSW 12 104389649 nonsense probably null
R4924:Serpina3m UTSW 12 104391470 missense probably benign 0.00
R4964:Serpina3m UTSW 12 104389101 missense probably benign 0.43
R5723:Serpina3m UTSW 12 104393911 missense probably damaging 0.96
R5836:Serpina3m UTSW 12 104389250 missense probably damaging 1.00
R6172:Serpina3m UTSW 12 104389227 missense probably damaging 1.00
R6619:Serpina3m UTSW 12 104391507 missense probably benign 0.02
R6857:Serpina3m UTSW 12 104389326 missense probably damaging 1.00
R6886:Serpina3m UTSW 12 104389127 missense possibly damaging 0.94
R7063:Serpina3m UTSW 12 104391467 missense probably benign 0.00
R7170:Serpina3m UTSW 12 104389518 missense probably damaging 1.00
R7622:Serpina3m UTSW 12 104389575 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGAAGTTTCTGACCACACGC -3'
(R):5'- AACCACAGCTCCTTGTTCTAGC -3'

Sequencing Primer
(F):5'- ACGCCACTTCCGTGATGAG -3'
(R):5'- TAGCTGATCCCATCTTGTGAACAAC -3'
Posted On2015-04-30