Incidental Mutation 'R4057:Stag2'
ID314310
Institutional Source Beutler Lab
Gene Symbol Stag2
Ensembl Gene ENSMUSG00000025862
Gene Namestromal antigen 2
Synonymsnuclear protein SA2, SA-2, 9230105L23Rik, SAP2, B230112I07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R4057 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location42149317-42277185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42224942 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 228 (T228A)
Ref Sequence ENSEMBL: ENSMUSP00000110725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069619] [ENSMUST00000115072] [ENSMUST00000115073] [ENSMUST00000128799]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069619
AA Change: T228A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063250
Gene: ENSMUSG00000025862
AA Change: T228A

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 154 273 3e-50 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115072
AA Change: T228A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110724
Gene: ENSMUSG00000025862
AA Change: T228A

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 154 273 3e-50 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115073
AA Change: T228A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110725
Gene: ENSMUSG00000025862
AA Change: T228A

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 157 271 6.3e-41 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
coiled coil region 1169 1189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128799
SMART Domains Protein: ENSMUSP00000120592
Gene: ENSMUSG00000025862

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Meta Mutation Damage Score 0.2451 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the cohesin complex, which regulates the separation of sister chromatids during cell division. Targeted inactivation of this gene results in chromatid cohesion defects and aneuploidy, suggesting that genetic disruption of cohesin is a cause of aneuploidy in human cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Knockdown of expression of this gene results in lineage skewing of hematopoietic stem cells and myeloproliferative disorders in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,025 M1686K probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Asb2 A G 12: 103,325,394 Y377H probably benign Het
Cars T C 7: 143,570,648 E347G probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst T C 1: 34,186,054 probably benign Het
Emcn C A 3: 137,379,899 T86K probably damaging Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Hmcn2 A G 2: 31,400,238 Y2361C probably damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Ltbp1 G T 17: 75,310,194 G725C probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Myo3a T A 2: 22,266,160 M144K probably benign Het
Nav3 A T 10: 109,880,533 probably null Het
Neb A T 2: 52,206,699 V5000D possibly damaging Het
Neb G T 2: 52,237,108 A3534E probably benign Het
Nlrp9a T A 7: 26,570,646 C833S probably benign Het
Npas1 C A 7: 16,474,787 R55L probably damaging Het
Olfr659 A G 7: 104,671,269 K189R probably damaging Het
P2ry10 T C X: 107,103,256 C266R probably damaging Het
Pcdh1 T C 18: 38,198,897 E351G probably damaging Het
Plce1 A T 19: 38,760,119 R1751W probably damaging Het
Plekhn1 T C 4: 156,224,693 probably null Het
Por A G 5: 135,731,574 Y245C probably damaging Het
Ptprm A C 17: 67,075,663 I158S possibly damaging Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Serpina3m A C 12: 104,391,737 probably benign Het
Sox5 G T 6: 144,116,522 R135S probably damaging Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Other mutations in Stag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Stag2 APN X 42247015 missense probably benign 0.17
IGL02379:Stag2 APN X 42250597 missense probably benign 0.00
IGL02501:Stag2 APN X 42271325 splice site probably benign
R0194:Stag2 UTSW X 42206137 splice site probably benign
R4465:Stag2 UTSW X 42233872 missense probably benign 0.00
R4466:Stag2 UTSW X 42233872 missense probably benign 0.00
R4467:Stag2 UTSW X 42233872 missense probably benign 0.00
R5007:Stag2 UTSW X 42266253 missense possibly damaging 0.92
Z1177:Stag2 UTSW X 42229398 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGATTGAGAGATAACCCAATCCATG -3'
(R):5'- GCAGGTTGGCTGCATAATAATAGC -3'

Sequencing Primer
(F):5'- GTCAAAAGCAGATTAGCTGTTCTTCG -3'
(R):5'- TGGCTGCATAATAATAGCCTAAACAC -3'
Posted On2015-04-30