Incidental Mutation 'R4058:Rgs8'
ID314316
Institutional Source Beutler Lab
Gene Symbol Rgs8
Ensembl Gene ENSMUSG00000042671
Gene Nameregulator of G-protein signaling 8
Synonyms6530413N01Rik
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location153653025-153700323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153690996 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 98 (T98A)
Ref Sequence ENSEMBL: ENSMUSP00000122518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041776] [ENSMUST00000111810] [ENSMUST00000111812] [ENSMUST00000111814] [ENSMUST00000111815] [ENSMUST00000124500] [ENSMUST00000147482] [ENSMUST00000147700] [ENSMUST00000152114]
Predicted Effect probably benign
Transcript: ENSMUST00000041776
AA Change: T98A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045715
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111810
AA Change: T98A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107441
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111812
AA Change: T98A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107443
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111814
AA Change: T96A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107445
Gene: ENSMUSG00000042671
AA Change: T96A

DomainStartEndE-ValueType
RGS 54 170 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111815
AA Change: T96A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107446
Gene: ENSMUSG00000042671
AA Change: T96A

DomainStartEndE-ValueType
RGS 54 170 1.83e-53 SMART
Predicted Effect probably null
Transcript: ENSMUST00000124500
AA Change: T98A

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122518
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
Pfam:RGS 56 99 2.3e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147482
AA Change: T96A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118365
Gene: ENSMUSG00000042671
AA Change: T96A

DomainStartEndE-ValueType
Pfam:RGS 54 115 6.5e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147700
AA Change: T98A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123565
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
Pfam:RGS 56 115 1.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152114
AA Change: T98A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121910
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
RGS 56 137 1.52e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187154
Meta Mutation Damage Score 0.1425 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulator of G protein signaling (RGS) family and encodes a protein with a single RGS domain. Regulator of G protein signaling (RGS) proteins are regulatory and structural components of G protein-coupled receptor complexes. They accelerate transit through the cycle of GTP binding and hydrolysis to GDP, thereby terminating signal transduction, but paradoxically, also accelerate receptor-stimulated activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility and Purkinje cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Rgs8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02100:Rgs8 APN 1 153692723 critical splice acceptor site probably null
IGL02163:Rgs8 APN 1 153671765 missense possibly damaging 0.71
IGL02826:Rgs8 APN 1 153670799 missense probably damaging 1.00
IGL03345:Rgs8 APN 1 153692810 missense probably benign 0.34
R0561:Rgs8 UTSW 1 153665922 splice site probably null
R0801:Rgs8 UTSW 1 153670811 missense probably damaging 1.00
R3618:Rgs8 UTSW 1 153690996 missense probably null 0.35
R4059:Rgs8 UTSW 1 153690996 missense probably null 0.35
R4877:Rgs8 UTSW 1 153692887 unclassified probably benign
R5070:Rgs8 UTSW 1 153665904 missense probably damaging 0.97
R5841:Rgs8 UTSW 1 153692828 missense probably damaging 1.00
R6028:Rgs8 UTSW 1 153690988 missense probably damaging 1.00
R6413:Rgs8 UTSW 1 153692873 missense probably damaging 1.00
R7682:Rgs8 UTSW 1 153690922 missense probably damaging 1.00
X0028:Rgs8 UTSW 1 153670846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGACTAGTCAGGATGCTG -3'
(R):5'- ACGCCTTTCTCATCAGGATC -3'

Sequencing Primer
(F):5'- CAGGATGCTGACAAATTGGTATTG -3'
(R):5'- TTTCTCATCAGGATCCAACTCAACAG -3'
Posted On2015-04-30