Incidental Mutation 'R0388:Kcnq3'
ID31432
Institutional Source Beutler Lab
Gene Symbol Kcnq3
Ensembl Gene ENSMUSG00000056258
Gene Namepotassium voltage-gated channel, subfamily Q, member 3
Synonyms
MMRRC Submission 038594-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R0388 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location65986387-66286642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66000038 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 594 (Y594F)
Ref Sequence ENSEMBL: ENSMUSP00000063380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070256]
Predicted Effect probably benign
Transcript: ENSMUST00000070256
AA Change: Y594F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000063380
Gene: ENSMUSG00000056258
AA Change: Y594F

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
Pfam:Ion_trans 122 364 9.9e-31 PFAM
Pfam:Ion_trans_2 268 357 3.4e-14 PFAM
Pfam:KCNQ_channel 448 658 1.4e-89 PFAM
Pfam:KCNQC3-Ank-G_bd 771 867 3.8e-41 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the regulation of neuronal excitability. The encoded protein forms an M-channel by associating with the products of the related KCNQ2 or KCNQ5 genes, which both encode integral membrane proteins. M-channel currents are inhibited by M1 muscarinic acetylcholine receptors and are activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 2 (BFNC2), also known as epilepsy, benign neonatal type 2 (EBN2). Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal apamin-insensitive afterhyperpolarization currents in granule cells, but not pyramidal cells, of the hippocampus. Mice homozygous for a knock-in allele exhibit spontaneous seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Kcnq3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Kcnq3 APN 15 65995271 missense probably damaging 1.00
IGL00808:Kcnq3 APN 15 65995754 missense possibly damaging 0.49
IGL00969:Kcnq3 APN 15 66004726 missense probably damaging 1.00
IGL01121:Kcnq3 APN 15 66005977 splice site probably benign
IGL01996:Kcnq3 APN 15 66023696 missense probably damaging 0.98
IGL02153:Kcnq3 APN 15 66025191 missense probably damaging 0.96
IGL02950:Kcnq3 APN 15 66020293 missense probably benign 0.12
IGL02963:Kcnq3 APN 15 66285826 splice site probably benign
IGL03102:Kcnq3 APN 15 66028788 missense probably damaging 1.00
IGL03050:Kcnq3 UTSW 15 66025178 missense possibly damaging 0.52
R0345:Kcnq3 UTSW 15 66020305 missense possibly damaging 0.55
R0730:Kcnq3 UTSW 15 65995608 missense probably benign
R1173:Kcnq3 UTSW 15 66000042 missense probably benign 0.01
R1610:Kcnq3 UTSW 15 66025260 missense probably damaging 1.00
R1678:Kcnq3 UTSW 15 66031432 missense probably damaging 1.00
R1714:Kcnq3 UTSW 15 66000063 missense probably benign 0.21
R1755:Kcnq3 UTSW 15 65995421 missense probably damaging 1.00
R1768:Kcnq3 UTSW 15 66005906 missense probably damaging 0.98
R1873:Kcnq3 UTSW 15 66002255 missense probably benign 0.16
R1925:Kcnq3 UTSW 15 66004809 missense possibly damaging 0.75
R1970:Kcnq3 UTSW 15 66028623 critical splice donor site probably null
R2140:Kcnq3 UTSW 15 66005978 splice site probably benign
R2141:Kcnq3 UTSW 15 65995851 missense probably benign 0.21
R2149:Kcnq3 UTSW 15 66023729 missense probably damaging 1.00
R2212:Kcnq3 UTSW 15 66020293 missense probably benign
R2272:Kcnq3 UTSW 15 66028680 missense probably damaging 1.00
R2566:Kcnq3 UTSW 15 66031427 missense probably damaging 1.00
R2909:Kcnq3 UTSW 15 66025236 missense possibly damaging 0.87
R3703:Kcnq3 UTSW 15 66021739 critical splice donor site probably null
R3704:Kcnq3 UTSW 15 66021739 critical splice donor site probably null
R3899:Kcnq3 UTSW 15 66030523 missense probably benign 0.01
R4096:Kcnq3 UTSW 15 66285815 splice site probably null
R4421:Kcnq3 UTSW 15 65995511 missense probably benign 0.01
R4504:Kcnq3 UTSW 15 65995342 nonsense probably null
R4505:Kcnq3 UTSW 15 65995342 nonsense probably null
R4571:Kcnq3 UTSW 15 66030612 missense probably damaging 1.00
R4577:Kcnq3 UTSW 15 66286214 missense unknown
R4900:Kcnq3 UTSW 15 65995410 missense probably damaging 1.00
R4981:Kcnq3 UTSW 15 66031405 missense possibly damaging 0.84
R5015:Kcnq3 UTSW 15 66004763 missense probably damaging 1.00
R5049:Kcnq3 UTSW 15 66285897 missense probably benign 0.17
R5245:Kcnq3 UTSW 15 66031435 missense possibly damaging 0.89
R5334:Kcnq3 UTSW 15 66025224 missense probably damaging 1.00
R5528:Kcnq3 UTSW 15 66025178 missense probably damaging 0.97
R5532:Kcnq3 UTSW 15 65997773 nonsense probably null
R5630:Kcnq3 UTSW 15 66025122 missense probably damaging 1.00
R5639:Kcnq3 UTSW 15 65997750 missense probably damaging 0.96
R5936:Kcnq3 UTSW 15 66000110 missense probably damaging 1.00
R6306:Kcnq3 UTSW 15 66004794 missense probably benign 0.40
R6576:Kcnq3 UTSW 15 66025178 missense possibly damaging 0.52
R7006:Kcnq3 UTSW 15 66020316 nonsense probably null
R7403:Kcnq3 UTSW 15 66002217 missense probably damaging 1.00
R8140:Kcnq3 UTSW 15 65995541 missense probably damaging 1.00
RF045:Kcnq3 UTSW 15 66286184 small deletion probably benign
X0060:Kcnq3 UTSW 15 66031386 missense probably damaging 1.00
Z1177:Kcnq3 UTSW 15 65995452 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCTTGGAAGGGGTATCGGTCAAGC -3'
(R):5'- TCACTCCCTCAGACTTCAGAAGATAGC -3'

Sequencing Primer
(F):5'- AGCTGACGCATTAGCTCC -3'
(R):5'- GACTTCAGAAGATAGCAATATCATGC -3'
Posted On2013-04-24