Incidental Mutation 'R4058:Olfr1031'
ID314321
Institutional Source Beutler Lab
Gene Symbol Olfr1031
Ensembl Gene ENSMUSG00000043267
Gene Nameolfactory receptor 1031
SynonymsGA_x6K02T2Q125-47470765-47471775, MOR200-1
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85990304-85993704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85992232 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 138 (S138R)
Ref Sequence ENSEMBL: ENSMUSP00000149225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050942] [ENSMUST00000056849] [ENSMUST00000216807]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050942
AA Change: S138R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059256
Gene: ENSMUSG00000043267
AA Change: S138R

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.1e-55 PFAM
Pfam:7tm_1 40 289 6.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056849
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216807
AA Change: S138R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Olfr1031
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Olfr1031 APN 2 85992386 missense probably damaging 1.00
IGL02475:Olfr1031 APN 2 85992032 missense probably benign 0.19
IGL03230:Olfr1031 APN 2 85992239 missense probably benign 0.00
IGL03405:Olfr1031 APN 2 85991886 missense possibly damaging 0.84
PIT4151001:Olfr1031 UTSW 2 85992194 missense probably damaging 0.96
PIT4366001:Olfr1031 UTSW 2 85992041 missense probably damaging 1.00
R0344:Olfr1031 UTSW 2 85992382 nonsense probably null
R1168:Olfr1031 UTSW 2 85992684 missense probably damaging 1.00
R1170:Olfr1031 UTSW 2 85992696 missense probably damaging 1.00
R2345:Olfr1031 UTSW 2 85991822 missense probably benign 0.01
R2915:Olfr1031 UTSW 2 85992045 missense probably damaging 1.00
R3498:Olfr1031 UTSW 2 85992430 missense probably benign 0.43
R4747:Olfr1031 UTSW 2 85991927 missense probably damaging 1.00
R4859:Olfr1031 UTSW 2 85992731 missense probably damaging 0.96
R4991:Olfr1031 UTSW 2 85992287 missense probably damaging 0.99
R5438:Olfr1031 UTSW 2 85992581 missense probably damaging 1.00
R6362:Olfr1031 UTSW 2 85991941 missense probably damaging 1.00
R7458:Olfr1031 UTSW 2 85992650 missense probably damaging 1.00
R7535:Olfr1031 UTSW 2 85991901 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GGATATGTGCTTCTCTTCCAATGTG -3'
(R):5'- TCCAGCTACAACAAGCATGG -3'

Sequencing Primer
(F):5'- CAAAGATGCTCCAGATTTTCCTG -3'
(R):5'- CTACAACAAGCATGGAGGTTTC -3'
Posted On2015-04-30