Incidental Mutation 'R4058:Lmo2'
ID314322
Institutional Source Beutler Lab
Gene Symbol Lmo2
Ensembl Gene ENSMUSG00000032698
Gene NameLIM domain only 2
SynonymsRbtn2, Rhom-2, Rbtn-2
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location103957986-103981878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103981062 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 147 (Y147H)
Ref Sequence ENSEMBL: ENSMUSP00000106769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111139] [ENSMUST00000111140] [ENSMUST00000111143] [ENSMUST00000123437] [ENSMUST00000138815] [ENSMUST00000156813] [ENSMUST00000170926]
Predicted Effect probably damaging
Transcript: ENSMUST00000111139
AA Change: Y147H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106769
Gene: ENSMUSG00000032698
AA Change: Y147H

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
LIM 91 145 1.71e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111140
AA Change: Y219H

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106770
Gene: ENSMUSG00000032698
AA Change: Y219H

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
LIM 99 153 4.03e-10 SMART
LIM 163 217 1.71e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111143
AA Change: Y211H

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106773
Gene: ENSMUSG00000032698
AA Change: Y211H

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
LIM 91 145 4.03e-10 SMART
LIM 155 209 1.71e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123437
AA Change: Y149H

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117703
Gene: ENSMUSG00000032698
AA Change: Y149H

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 147 1.71e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133210
Predicted Effect probably benign
Transcript: ENSMUST00000138815
SMART Domains Protein: ENSMUSP00000121927
Gene: ENSMUSG00000032698

DomainStartEndE-ValueType
Pfam:LIM 30 59 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156813
SMART Domains Protein: ENSMUSP00000122369
Gene: ENSMUSG00000032698

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 144 1.36e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170926
AA Change: Y149H

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128317
Gene: ENSMUSG00000032698
AA Change: Y149H

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 147 1.71e-13 SMART
Meta Mutation Damage Score 0.1446 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LMO2 encodes a cysteine-rich, two LIM-domain protein that is required for yolk sac erythropoiesis. The LMO2 protein has a central and crucial role in hematopoietic development and is highly conserved. The LMO2 transcription start site is located approximately 25 kb downstream from the 11p13 T-cell translocation cluster (11p13 ttc), where a number T-cell acute lymphoblastic leukemia-specific translocations occur. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lack of yolk sac erythropoiesis and die around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Lmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Lmo2 APN 2 103981087 missense probably benign 0.21
R1983:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2013:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2014:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2131:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2132:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2133:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2233:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2235:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2510:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R3038:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R3813:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4059:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4448:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4450:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4544:Lmo2 UTSW 2 103976037 missense probably damaging 1.00
R4805:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4808:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4975:Lmo2 UTSW 2 103976143 nonsense probably null
R5310:Lmo2 UTSW 2 103976100 missense probably damaging 0.98
R5823:Lmo2 UTSW 2 103981072 missense probably damaging 1.00
R6267:Lmo2 UTSW 2 103970601 missense possibly damaging 0.86
R6296:Lmo2 UTSW 2 103970601 missense possibly damaging 0.86
R6949:Lmo2 UTSW 2 103970673 start codon destroyed probably null 0.53
R8051:Lmo2 UTSW 2 103970700 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGTGCATCCTGTGACAAGC -3'
(R):5'- AATTCTCTCTAAGGGCTGGTCC -3'

Sequencing Primer
(F):5'- ATCCTGTGACAAGCGGATC -3'
(R):5'- GAAGTCTCAGCCTTTGCATTATG -3'
Posted On2015-04-30