Incidental Mutation 'R4058:H13'
ID314325
Institutional Source Beutler Lab
Gene Symbol H13
Ensembl Gene ENSMUSG00000019188
Gene Namehistocompatibility 13
SynonymsSpp, 1200006O09Rik, H-13, 5031424B04Rik, 4930443L17Rik
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152669461-152708670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 152691874 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 227 (P227R)
Ref Sequence ENSEMBL: ENSMUSP00000078236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062148] [ENSMUST00000079247] [ENSMUST00000089059] [ENSMUST00000125366]
Predicted Effect probably benign
Transcript: ENSMUST00000062148
SMART Domains Protein: ENSMUSP00000100534
Gene: ENSMUSG00000042814

DomainStartEndE-ValueType
Blast:PSN 40 63 9e-7 BLAST
PUA 93 171 3.41e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079247
AA Change: P227R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078236
Gene: ENSMUSG00000019188
AA Change: P227R

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
PSN 66 295 1.74e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089059
AA Change: P269R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086460
Gene: ENSMUSG00000019188
AA Change: P269R

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
PSN 66 337 1.56e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125366
AA Change: P269R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120068
Gene: ENSMUSG00000019188
AA Change: P269R

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
PSN 66 337 1.56e-119 SMART
low complexity region 355 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180725
Meta Mutation Damage Score 0.9697 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, which localizes to the endoplasmic reticulum, catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein. This activity is required to generate signal sequence-derived human lymphocyte antigen-E epitopes that are recognized by the immune system, and to process hepatitis C virus core protein. The encoded protein is an integral membrane protein with sequence motifs characteristic of the presenilin-type aspartic proteases. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: This is one of several loci identified by development of congenic strains differing in resistance to transplantable tumors. C57BL/10 carries the a allele and B10.129(14M) carries the b allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in H13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02526:H13 APN 2 152688682 missense probably damaging 0.98
R0100:H13 UTSW 2 152689863 splice site probably null
R0100:H13 UTSW 2 152689863 splice site probably null
R0106:H13 UTSW 2 152686256 missense probably benign 0.09
R0178:H13 UTSW 2 152681067 missense probably damaging 1.00
R2880:H13 UTSW 2 152695561 missense probably damaging 1.00
R4110:H13 UTSW 2 152681109 missense probably damaging 0.99
R4397:H13 UTSW 2 152677552 missense probably damaging 0.98
R5698:H13 UTSW 2 152688955 missense probably damaging 1.00
R7145:H13 UTSW 2 152681072 missense probably damaging 1.00
R7773:H13 UTSW 2 152695511 missense probably damaging 1.00
R8116:H13 UTSW 2 152695526 missense probably damaging 1.00
R8192:H13 UTSW 2 152669602 missense probably benign
R8362:H13 UTSW 2 152686391 missense unknown
R8409:H13 UTSW 2 152689893 missense possibly damaging 0.94
RF005:H13 UTSW 2 152669669 missense probably damaging 1.00
RF008:H13 UTSW 2 152669669 missense probably damaging 1.00
RF016:H13 UTSW 2 152669669 missense probably damaging 1.00
RF019:H13 UTSW 2 152669669 missense probably damaging 1.00
RF023:H13 UTSW 2 152669669 missense probably damaging 1.00
RF024:H13 UTSW 2 152669669 missense probably damaging 1.00
X0019:H13 UTSW 2 152681070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTGCCATTTCATCCTCTGAG -3'
(R):5'- GAAGAGACATGCCGAATGCC -3'

Sequencing Primer
(F):5'- CAAATGTGTGTGAGTCATATTTCAC -3'
(R):5'- TGCCGAATGCCACCAAAC -3'
Posted On2015-04-30