Incidental Mutation 'R4058:Olfr1328'
ID314330
Institutional Source Beutler Lab
Gene Symbol Olfr1328
Ensembl Gene ENSMUSG00000111259
Gene Nameolfactory receptor 1328
SynonymsOlfr1519, MOR259-1, MOR259-13, MOR259-1, GA_x6K02T2QD9B-18602750-18603691
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118930071-118938612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118934683 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 53 (D53G)
Ref Sequence ENSEMBL: ENSMUSP00000080626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081960] [ENSMUST00000215312]
Predicted Effect probably damaging
Transcript: ENSMUST00000081960
AA Change: D53G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080626
Gene: ENSMUSG00000111259
AA Change: D53G

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 36 306 9.1e-8 PFAM
Pfam:7tm_1 42 291 1.7e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215312
AA Change: D55G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.7372 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Olfr1328
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr1328 APN 4 118934161 missense probably damaging 1.00
IGL02685:Olfr1328 APN 4 118933937 missense possibly damaging 0.61
IGL02886:Olfr1328 APN 4 118934830 missense probably benign
IGL02899:Olfr1328 APN 4 118934662 missense probably damaging 1.00
IGL02957:Olfr1328 APN 4 118934119 missense probably damaging 1.00
PIT4453001:Olfr1328 UTSW 4 118934626 missense probably benign
R0211:Olfr1328 UTSW 4 118934270 missense probably benign 0.00
R0211:Olfr1328 UTSW 4 118934270 missense probably benign 0.00
R1158:Olfr1328 UTSW 4 118934417 missense probably damaging 1.00
R1450:Olfr1328 UTSW 4 118934510 missense probably benign 0.01
R1682:Olfr1328 UTSW 4 118934581 missense probably damaging 1.00
R1978:Olfr1328 UTSW 4 118934184 nonsense probably null
R2363:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2364:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2365:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2507:Olfr1328 UTSW 4 118933925 missense probably benign
R2912:Olfr1328 UTSW 4 118934701 missense probably benign 0.28
R3937:Olfr1328 UTSW 4 118934683 missense probably damaging 1.00
R4089:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R4090:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R4419:Olfr1328 UTSW 4 118934389 missense possibly damaging 0.56
R4717:Olfr1328 UTSW 4 118934429 missense probably benign 0.45
R5570:Olfr1328 UTSW 4 118934066 missense possibly damaging 0.88
R5591:Olfr1328 UTSW 4 118934461 missense probably damaging 1.00
R6149:Olfr1328 UTSW 4 118934431 missense probably damaging 1.00
R7202:Olfr1328 UTSW 4 118934018 missense probably benign
R7214:Olfr1328 UTSW 4 118933949 missense possibly damaging 0.88
R7391:Olfr1328 UTSW 4 118934001 missense possibly damaging 0.61
R7666:Olfr1328 UTSW 4 118934264 missense probably damaging 1.00
R7676:Olfr1328 UTSW 4 118934150 missense probably damaging 1.00
R8053:Olfr1328 UTSW 4 118934111 missense probably damaging 1.00
R8311:Olfr1328 UTSW 4 118934150 missense probably damaging 0.97
Z1176:Olfr1328 UTSW 4 118933918 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTCAGTTATACCCAGGGCAC -3'
(R):5'- TGCCTCTATTGCTGGCATG -3'

Sequencing Primer
(F):5'- GGCACCAAACACATACATCTGCAG -3'
(R):5'- GAATAATGGATTCTCTTACAGCCTCC -3'
Posted On2015-04-30