Incidental Mutation 'R4058:Megf6'
ID314331
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 154242532 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect probably benign
Transcript: ENSMUST00000030897
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152159
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
Didactic UTSW 4 154254587 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 splice site probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
R7345:Megf6 UTSW 4 154267315 missense probably benign
R7580:Megf6 UTSW 4 154270744 nonsense probably null
R7649:Megf6 UTSW 4 154265085 missense probably damaging 0.96
R7702:Megf6 UTSW 4 154270470 missense probably benign 0.00
R8010:Megf6 UTSW 4 154270507 missense probably benign 0.13
R8175:Megf6 UTSW 4 154268619 nonsense probably null
R8231:Megf6 UTSW 4 154252518 missense probably damaging 1.00
R8436:Megf6 UTSW 4 154265192 missense probably damaging 1.00
R8460:Megf6 UTSW 4 154266177 nonsense probably null
R8738:Megf6 UTSW 4 154267979 missense probably benign
Z1177:Megf6 UTSW 4 154237826 missense probably benign 0.12
Z1177:Megf6 UTSW 4 154250849 missense probably damaging 1.00
Z1177:Megf6 UTSW 4 154267681 missense possibly damaging 0.48
Z1177:Megf6 UTSW 4 154267682 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154267747 nonsense probably null
Z1177:Megf6 UTSW 4 154269741 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGTCTGAGAAGGTCTTGAGTTTG -3'
(R):5'- GTGCAGTAAAGGTGCGCTTAG -3'

Sequencing Primer
(F):5'- TAGCCCAGTGTGTACCTAGCTG -3'
(R):5'- TAAAGGTGCGCTTAGGACTCC -3'
Posted On2015-04-30