Incidental Mutation 'R4058:C130060K24Rik'
ID314335
Institutional Source Beutler Lab
Gene Symbol C130060K24Rik
Ensembl Gene ENSMUSG00000029917
Gene NameRIKEN cDNA C130060K24 gene
Synonyms
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location65381105-65458150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65381541 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 83 (I83N)
Ref Sequence ENSEMBL: ENSMUSP00000130225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133352] [ENSMUST00000170608]
Predicted Effect probably damaging
Transcript: ENSMUST00000133352
AA Change: I83N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122416
Gene: ENSMUSG00000029917
AA Change: I83N

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 55 113 1.2e-7 PFAM
Pfam:7tm_1 61 122 1.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170608
AA Change: I83N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130225
Gene: ENSMUSG00000029917
AA Change: I83N

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 55 346 2.5e-5 PFAM
Pfam:7tm_1 61 331 7.2e-56 PFAM
Meta Mutation Damage Score 0.9672 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in C130060K24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:C130060K24Rik APN 6 65381610 missense probably benign 0.36
IGL03335:C130060K24Rik APN 6 65453117 critical splice donor site probably null
R1291:C130060K24Rik UTSW 6 65452900 nonsense probably null
R1689:C130060K24Rik UTSW 6 65381607 missense possibly damaging 0.84
R1705:C130060K24Rik UTSW 6 65456306 missense probably benign 0.01
R2188:C130060K24Rik UTSW 6 65441276 missense probably damaging 0.97
R3955:C130060K24Rik UTSW 6 65453108 missense possibly damaging 0.73
R4572:C130060K24Rik UTSW 6 65454991 missense probably benign 0.06
R4597:C130060K24Rik UTSW 6 65447424 critical splice donor site probably null
R4756:C130060K24Rik UTSW 6 65452914 missense probably benign 0.02
R5139:C130060K24Rik UTSW 6 65456219 missense probably damaging 0.98
R5872:C130060K24Rik UTSW 6 65441385 intron probably benign
R6193:C130060K24Rik UTSW 6 65456158 missense probably damaging 1.00
R6305:C130060K24Rik UTSW 6 65454991 missense probably benign 0.06
R6423:C130060K24Rik UTSW 6 65456093 missense probably benign 0.01
R6453:C130060K24Rik UTSW 6 65453030 missense possibly damaging 0.71
R6677:C130060K24Rik UTSW 6 65456245 missense probably benign
R6744:C130060K24Rik UTSW 6 65441340 missense possibly damaging 0.88
R6793:C130060K24Rik UTSW 6 65381421 missense probably benign 0.20
R6875:C130060K24Rik UTSW 6 65456336 missense probably benign 0.21
R6941:C130060K24Rik UTSW 6 65447401 missense probably damaging 1.00
R6995:C130060K24Rik UTSW 6 65441301 missense probably damaging 1.00
R7063:C130060K24Rik UTSW 6 65441403 intron probably benign
R7564:C130060K24Rik UTSW 6 65452907 nonsense probably null
R7699:C130060K24Rik UTSW 6 65452956 missense probably benign 0.30
R7700:C130060K24Rik UTSW 6 65452956 missense probably benign 0.30
R7711:C130060K24Rik UTSW 6 65441373 missense
R7799:C130060K24Rik UTSW 6 65456137 missense possibly damaging 0.78
R7801:C130060K24Rik UTSW 6 65441217 missense probably damaging 1.00
RF018:C130060K24Rik UTSW 6 65456190 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTCGTGGAACTTGACCG -3'
(R):5'- GTAAGCCCTGCTGAGAAGTTCC -3'

Sequencing Primer
(F):5'- TCAGTTCATCGCGCACTATGGG -3'
(R):5'- GTTCCAAAAATTCAGGGGTTCTC -3'
Posted On2015-04-30