Incidental Mutation 'R4058:Anxa4'
ID314336
Institutional Source Beutler Lab
Gene Symbol Anxa4
Ensembl Gene ENSMUSG00000029994
Gene Nameannexin A4
Synonymsannexin IV, Xanx-4, AIV, Anx4
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86736840-86793584 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 86757818 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001187] [ENSMUST00000113675] [ENSMUST00000123732] [ENSMUST00000123732] [ENSMUST00000127152] [ENSMUST00000155456] [ENSMUST00000155456] [ENSMUST00000204398] [ENSMUST00000204398] [ENSMUST00000204441] [ENSMUST00000204441]
Predicted Effect probably null
Transcript: ENSMUST00000001187
SMART Domains Protein: ENSMUSP00000001187
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
ANX 187 239 9.84e-23 SMART
ANX 262 314 2.37e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113675
SMART Domains Protein: ENSMUSP00000109305
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
ANX 187 239 9.84e-23 SMART
ANX 262 314 2.37e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123732
SMART Domains Protein: ENSMUSP00000115346
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 79 1.6e-13 SMART
ANX 81 133 6.69e-25 SMART
ANX 165 217 9.84e-23 SMART
Pfam:Annexin 227 254 1.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123732
SMART Domains Protein: ENSMUSP00000115346
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 79 1.6e-13 SMART
ANX 81 133 6.69e-25 SMART
ANX 165 217 9.84e-23 SMART
Pfam:Annexin 227 254 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127152
SMART Domains Protein: ENSMUSP00000138194
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129772
Predicted Effect probably null
Transcript: ENSMUST00000155456
SMART Domains Protein: ENSMUSP00000117378
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 22 69 1.06e-2 SMART
ANX 83 135 9.84e-23 SMART
ANX 158 210 2.37e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155456
SMART Domains Protein: ENSMUSP00000117378
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 22 69 1.06e-2 SMART
ANX 83 135 9.84e-23 SMART
ANX 158 210 2.37e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204398
SMART Domains Protein: ENSMUSP00000144961
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 7.1e-23 SMART
ANX 103 155 2.8e-27 SMART
ANX 187 239 4.3e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204398
SMART Domains Protein: ENSMUSP00000144961
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 7.1e-23 SMART
ANX 103 155 2.8e-27 SMART
ANX 187 239 4.3e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204441
SMART Domains Protein: ENSMUSP00000145421
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 7.1e-23 SMART
ANX 103 155 2.8e-27 SMART
ANX 187 239 4.3e-25 SMART
Pfam:Annexin 249 274 5.4e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204441
SMART Domains Protein: ENSMUSP00000145421
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 7.1e-23 SMART
ANX 103 155 2.8e-27 SMART
ANX 187 239 4.3e-25 SMART
Pfam:Annexin 249 274 5.4e-6 PFAM
Meta Mutation Damage Score 0.9584 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. ANX4 has 45 to 59% identity with other members of its family and shares a similar size and exon-intron organization. Isolated from human placenta, ANX4 encodes a protein that has possible interactions with ATP, and has in vitro anticoagulant activity and also inhibits phospholipase A2 activity. ANX4 is almost exclusively expressed in epithelial cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene-trapped allele often display abnormal maternal nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Anxa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Anxa4 APN 6 86752205 missense probably damaging 1.00
IGL02601:Anxa4 APN 6 86760701 missense probably benign 0.00
R0423:Anxa4 UTSW 6 86760737 missense probably damaging 1.00
R0948:Anxa4 UTSW 6 86741931 missense probably damaging 1.00
R1846:Anxa4 UTSW 6 86741911 splice site probably null
R2341:Anxa4 UTSW 6 86743153 missense probably benign 0.38
R5000:Anxa4 UTSW 6 86765784 utr 5 prime probably benign
R5390:Anxa4 UTSW 6 86753883 missense probably damaging 1.00
R6503:Anxa4 UTSW 6 86744667 missense probably damaging 1.00
R6897:Anxa4 UTSW 6 86743178 critical splice acceptor site probably null
R7625:Anxa4 UTSW 6 86737819 missense probably damaging 1.00
R8092:Anxa4 UTSW 6 86741891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCTCATCCTCTCATCTAG -3'
(R):5'- TTTCCTCACACAGGGGAGAC -3'

Sequencing Primer
(F):5'- AGCTGCTGCCCCATACC -3'
(R):5'- GGAGACCATTTCCTCACACAGG -3'
Posted On2015-04-30