Incidental Mutation 'R4058:Gys1'
ID314341
Institutional Source Beutler Lab
Gene Symbol Gys1
Ensembl Gene ENSMUSG00000003865
Gene Nameglycogen synthase 1, muscle
SynonymsGys3, MGS
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45434844-45456619 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 45448386 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003964] [ENSMUST00000211150]
Predicted Effect probably benign
Transcript: ENSMUST00000003964
SMART Domains Protein: ENSMUSP00000003964
Gene: ENSMUSG00000003865

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Glyco_transf_5 28 274 5.2e-8 PFAM
Pfam:Glycogen_syn 31 663 N/A PFAM
low complexity region 670 686 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
low complexity region 716 733 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209230
Predicted Effect probably benign
Transcript: ENSMUST00000209640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210715
Predicted Effect probably benign
Transcript: ENSMUST00000211150
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the addition of glucose monomers to the growing glycogen molecule through the formation of alpha-1,4-glycoside linkages. Mutations in this gene are associated with muscle glycogen storage disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display neonatal lethality due to impaired cardiac function and exhibit reduced reduced ventricular chamber size, dilated atria, vascular congestion, and liver hemorrhage. Mice homozygous for a knock-in allele show altered glycogen homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Gys1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gys1 APN 7 45444832 missense possibly damaging 0.88
IGL00870:Gys1 APN 7 45448013 critical splice donor site probably null
IGL01346:Gys1 APN 7 45442537 missense probably damaging 1.00
IGL02396:Gys1 APN 7 45439588 missense probably damaging 1.00
IGL03157:Gys1 APN 7 45439899 unclassified probably benign
IGL03196:Gys1 APN 7 45454817 splice site probably benign
R0095:Gys1 UTSW 7 45444649 missense possibly damaging 0.87
R0284:Gys1 UTSW 7 45436719 unclassified probably benign
R0537:Gys1 UTSW 7 45440001 missense probably damaging 1.00
R0622:Gys1 UTSW 7 45439995 missense probably damaging 1.00
R1749:Gys1 UTSW 7 45440032 missense probably damaging 1.00
R1968:Gys1 UTSW 7 45443546 missense probably damaging 1.00
R3953:Gys1 UTSW 7 45440046 missense probably damaging 1.00
R4626:Gys1 UTSW 7 45439534 missense probably damaging 1.00
R4661:Gys1 UTSW 7 45454834 missense probably damaging 1.00
R4998:Gys1 UTSW 7 45451544 intron probably benign
R5965:Gys1 UTSW 7 45455339 missense probably benign 0.25
R5987:Gys1 UTSW 7 45438105 missense probably benign 0.00
R6059:Gys1 UTSW 7 45455288 splice site probably null
R6481:Gys1 UTSW 7 45442969 missense possibly damaging 0.63
R6788:Gys1 UTSW 7 45444678 missense probably damaging 0.99
R6924:Gys1 UTSW 7 45443635 critical splice donor site probably null
R7006:Gys1 UTSW 7 45440013 missense probably damaging 1.00
R7029:Gys1 UTSW 7 45439584 missense possibly damaging 0.93
R7060:Gys1 UTSW 7 45440013 missense probably damaging 1.00
R7211:Gys1 UTSW 7 45448260 missense possibly damaging 0.88
R7237:Gys1 UTSW 7 45455162 missense probably benign 0.02
R7242:Gys1 UTSW 7 45439668 splice site probably null
R7593:Gys1 UTSW 7 45442936 missense probably damaging 0.99
R7641:Gys1 UTSW 7 45455071 missense probably damaging 0.98
R7674:Gys1 UTSW 7 45455071 missense probably damaging 0.98
R7756:Gys1 UTSW 7 45448302 missense probably benign 0.43
R8197:Gys1 UTSW 7 45442924 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTAGAAGTAGCTCAGCCCTTC -3'
(R):5'- CCTGGTTCATGTGCAACTCC -3'

Sequencing Primer
(F):5'- TCTCCTCTGTCGACAGGTG -3'
(R):5'- AGGTTATCAGTGTCGACGACC -3'
Posted On2015-04-30