Incidental Mutation 'R4058:Kdm8'
ID314343
Institutional Source Beutler Lab
Gene Symbol Kdm8
Ensembl Gene ENSMUSG00000030752
Gene Namelysine (K)-specific demethylase 8
Synonyms
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location125444676-125462269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125456494 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 65 (Y65N)
Ref Sequence ENSEMBL: ENSMUSP00000114890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033010] [ENSMUST00000135129]
Predicted Effect probably damaging
Transcript: ENSMUST00000033010
AA Change: Y241N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033010
Gene: ENSMUSG00000030752
AA Change: Y241N

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
JmjC 269 414 2.71e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135129
AA Change: Y65N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114890
Gene: ENSMUSG00000030752
AA Change: Y65N

DomainStartEndE-ValueType
Pfam:Cupin_8 13 152 1.4e-22 PFAM
Meta Mutation Damage Score 0.8741 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a histone lysine demethylase. Studies of a similar protein in mouse indicate a potential role for this protein as a tumor suppressor. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality during organogenesis associated with severe growth retardation and abnormal embryo turning. Observed phenotypes include open neural tubes and absent vitelline blood vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Kdm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Kdm8 APN 7 125461205 missense probably damaging 1.00
IGL01975:Kdm8 APN 7 125452357 missense probably benign 0.04
IGL02019:Kdm8 APN 7 125452486 missense probably damaging 0.98
IGL03387:Kdm8 APN 7 125455106 missense probably benign 0.00
R0321:Kdm8 UTSW 7 125461006 missense probably damaging 1.00
R0479:Kdm8 UTSW 7 125452640 missense probably damaging 1.00
R1995:Kdm8 UTSW 7 125452339 missense probably benign 0.00
R4760:Kdm8 UTSW 7 125455259 critical splice donor site probably null
R5683:Kdm8 UTSW 7 125455173 missense possibly damaging 0.93
R6876:Kdm8 UTSW 7 125452658 missense probably benign 0.00
R7189:Kdm8 UTSW 7 125460931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCTGGCCTTTCTATCG -3'
(R):5'- TCCTTTAAGAAAACAGTGCAGGTG -3'

Sequencing Primer
(F):5'- TCGAGAGAATGCTGTCAGGG -3'
(R):5'- ACATAGTCAAGCGCTGCTG -3'
Posted On2015-04-30