Incidental Mutation 'R4058:Plekhg1'
ID314347
Institutional Source Beutler Lab
Gene Symbol Plekhg1
Ensembl Gene ENSMUSG00000040624
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 1
SynonymsD10Ertd733e
MMRRC Submission 040969-MU
Accession Numbers

Ncbi RefSeq: NM_001159942.1, NM_001033253.3; MGI:2676551

Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location3740364-3967303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3957087 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 668 (D668G)
Ref Sequence ENSEMBL: ENSMUSP00000114056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042438] [ENSMUST00000120274]
Predicted Effect probably damaging
Transcript: ENSMUST00000042438
AA Change: D668G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040495
Gene: ENSMUSG00000040624
AA Change: D668G

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120274
AA Change: D668G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114056
Gene: ENSMUSG00000040624
AA Change: D668G

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136671
AA Change: D723G
SMART Domains Protein: ENSMUSP00000119950
Gene: ENSMUSG00000040624
AA Change: D723G

DomainStartEndE-ValueType
low complexity region 67 86 N/A INTRINSIC
RhoGEF 172 347 4.17e-52 SMART
PH 379 473 2.54e-6 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1242 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141367
Predicted Effect unknown
Transcript: ENSMUST00000154727
AA Change: D522G
SMART Domains Protein: ENSMUSP00000122131
Gene: ENSMUSG00000040624
AA Change: D522G

DomainStartEndE-ValueType
RhoGEF 4 146 2.25e-25 SMART
PH 178 272 2.54e-6 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 1006 1017 N/A INTRINSIC
low complexity region 1041 1052 N/A INTRINSIC
Meta Mutation Damage Score 0.1828 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
Allele List at MGI

All alleles(13) : Targeted(2) Gene trapped(11)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Plekhg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Plekhg1 APN 10 3963631 missense probably benign 0.02
IGL01639:Plekhg1 APN 10 3956751 missense probably damaging 0.98
IGL01766:Plekhg1 APN 10 3873400 missense probably damaging 1.00
IGL01983:Plekhg1 APN 10 3945904 missense probably damaging 1.00
IGL02226:Plekhg1 APN 10 3945916 missense probably damaging 0.99
IGL02420:Plekhg1 APN 10 3964106 missense probably damaging 1.00
IGL02441:Plekhg1 APN 10 3958103 missense possibly damaging 0.89
IGL02505:Plekhg1 APN 10 3957139 missense probably damaging 0.97
IGL02659:Plekhg1 APN 10 3957069 nonsense probably null
IGL02730:Plekhg1 APN 10 3873242 missense possibly damaging 0.59
BB006:Plekhg1 UTSW 10 3919170 missense probably damaging 0.99
BB016:Plekhg1 UTSW 10 3919170 missense probably damaging 0.99
PIT4453001:Plekhg1 UTSW 10 3963469 missense
R0041:Plekhg1 UTSW 10 3964076 nonsense probably null
R0041:Plekhg1 UTSW 10 3964074 missense probably benign 0.02
R0068:Plekhg1 UTSW 10 3940502 missense probably damaging 0.99
R0068:Plekhg1 UTSW 10 3940504 nonsense probably null
R0333:Plekhg1 UTSW 10 3964419 missense probably damaging 1.00
R0427:Plekhg1 UTSW 10 3964235 missense probably benign 0.01
R0499:Plekhg1 UTSW 10 3937971 missense probably damaging 1.00
R0504:Plekhg1 UTSW 10 3937853 missense probably damaging 1.00
R1499:Plekhg1 UTSW 10 3940538 splice site probably benign
R1501:Plekhg1 UTSW 10 3957361 missense probably benign 0.02
R1565:Plekhg1 UTSW 10 3940526 missense probably damaging 1.00
R1801:Plekhg1 UTSW 10 3963904 missense probably damaging 1.00
R1823:Plekhg1 UTSW 10 3903658 critical splice donor site probably null
R1858:Plekhg1 UTSW 10 3945917 missense possibly damaging 0.95
R1984:Plekhg1 UTSW 10 3958181 missense probably damaging 1.00
R2420:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2421:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2422:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2437:Plekhg1 UTSW 10 3963564 missense probably damaging 1.00
R2872:Plekhg1 UTSW 10 3963982 missense probably benign
R2872:Plekhg1 UTSW 10 3963982 missense probably benign
R3830:Plekhg1 UTSW 10 3873400 missense probably damaging 1.00
R4059:Plekhg1 UTSW 10 3957087 missense probably damaging 1.00
R4649:Plekhg1 UTSW 10 3956985 missense probably benign 0.00
R4731:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4732:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4733:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4772:Plekhg1 UTSW 10 3873127 missense probably benign 0.00
R4772:Plekhg1 UTSW 10 3873130 missense probably damaging 1.00
R4803:Plekhg1 UTSW 10 3957186 missense probably benign 0.02
R5086:Plekhg1 UTSW 10 3903649 missense probably damaging 1.00
R5175:Plekhg1 UTSW 10 3965516 unclassified probably benign
R5283:Plekhg1 UTSW 10 3956654 missense probably benign 0.00
R5862:Plekhg1 UTSW 10 3937914 missense probably damaging 1.00
R6163:Plekhg1 UTSW 10 3964369 missense probably damaging 1.00
R6564:Plekhg1 UTSW 10 3964153 missense probably damaging 1.00
R6700:Plekhg1 UTSW 10 3957373 missense probably benign
R6930:Plekhg1 UTSW 10 3963770 missense possibly damaging 0.56
R7033:Plekhg1 UTSW 10 3940251 missense probably damaging 0.97
R7200:Plekhg1 UTSW 10 3956810 missense
R7223:Plekhg1 UTSW 10 3873343 missense
R7353:Plekhg1 UTSW 10 3964327 missense
R7488:Plekhg1 UTSW 10 3957491 missense
R7554:Plekhg1 UTSW 10 3963647 missense
R7929:Plekhg1 UTSW 10 3919170 missense probably damaging 0.99
R8014:Plekhg1 UTSW 10 3957758 missense
R8104:Plekhg1 UTSW 10 3952326 missense
R8167:Plekhg1 UTSW 10 3957452 missense
R8167:Plekhg1 UTSW 10 3957453 missense
R8215:Plekhg1 UTSW 10 3957521 missense
R8263:Plekhg1 UTSW 10 3957651 missense
Predicted Primers PCR Primer
(F):5'- CCAGTAGTGCAGGTGAAAGC -3'
(R):5'- ACTTCCTGGTGTTCATGTACG -3'

Sequencing Primer
(F):5'- CAACGCATGCCCTCCTG -3'
(R):5'- ATGCCTCTTGACCACCGAG -3'
Posted On2015-04-30