Incidental Mutation 'R4058:Prep'
ID314348
Institutional Source Beutler Lab
Gene Symbol Prep
Ensembl Gene ENSMUSG00000019849
Gene Nameprolyl endopeptidase
Synonymsprolyl oligopeptidase, Pop, D10Wsu136e
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4058 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location45067203-45167198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45158371 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 660 (V660M)
Ref Sequence ENSEMBL: ENSMUSP00000097444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099858]
Predicted Effect probably benign
Transcript: ENSMUST00000099858
AA Change: V660M

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097444
Gene: ENSMUSG00000019849
AA Change: V660M

DomainStartEndE-ValueType
Pfam:Peptidase_S9_N 7 423 1.2e-170 PFAM
Pfam:Peptidase_S9 482 707 1.7e-72 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic prolyl endopeptidase that cleaves peptide bonds on the C-terminal side of prolyl residues within peptides that are up to approximately 30 amino acids long. Prolyl endopeptidases have been reported to be involved in the maturation and degradation of peptide hormones and neuropeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit sex-dependent resistance to diet-induced obesity and adiposity. Mice heterozygous for a gene trap allele exhibit maternal inheritance influenced increase in body weight, organ weight, and adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Prep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Prep APN 10 45115173 missense probably damaging 1.00
IGL01412:Prep APN 10 45153112 missense probably damaging 1.00
IGL01577:Prep APN 10 45072048 splice site probably benign
IGL02751:Prep APN 10 45115186 missense probably damaging 1.00
IGL02754:Prep APN 10 45067332 start codon destroyed probably null 0.23
IGL02875:Prep APN 10 45158433 missense probably damaging 1.00
IGL02957:Prep APN 10 45126030 missense probably benign 0.44
R0008:Prep UTSW 10 45115078 missense probably benign 0.17
R0008:Prep UTSW 10 45115078 missense probably benign 0.17
R0167:Prep UTSW 10 45158230 critical splice acceptor site probably null
R0396:Prep UTSW 10 45092676 missense probably damaging 1.00
R0828:Prep UTSW 10 45155525 missense probably benign 0.01
R1309:Prep UTSW 10 45126026 missense probably benign
R2166:Prep UTSW 10 45092655 splice site probably benign
R4020:Prep UTSW 10 45092798 splice site probably benign
R4162:Prep UTSW 10 45067362 missense possibly damaging 0.96
R4163:Prep UTSW 10 45067340 missense probably benign
R4163:Prep UTSW 10 45067362 missense possibly damaging 0.96
R4328:Prep UTSW 10 45120649 missense probably benign
R4343:Prep UTSW 10 45120770 missense probably damaging 0.99
R4493:Prep UTSW 10 45120819 missense probably benign 0.38
R4495:Prep UTSW 10 45120819 missense probably benign 0.38
R5192:Prep UTSW 10 45153111 missense probably benign 0.28
R5569:Prep UTSW 10 45097437 missense probably benign
R5888:Prep UTSW 10 45067364 missense possibly damaging 0.74
R5999:Prep UTSW 10 45072129 critical splice donor site probably null
R6468:Prep UTSW 10 45115107 missense probably damaging 1.00
R6556:Prep UTSW 10 45158314 frame shift probably null
R6696:Prep UTSW 10 45153078 missense probably damaging 1.00
R6737:Prep UTSW 10 45097495 missense possibly damaging 0.62
R6762:Prep UTSW 10 45148123 critical splice donor site probably null
R6830:Prep UTSW 10 45097501 missense probably benign 0.01
R7105:Prep UTSW 10 45126063 missense probably benign
R7193:Prep UTSW 10 45092699 missense probably benign 0.00
R7466:Prep UTSW 10 45150438 missense probably benign 0.32
R7492:Prep UTSW 10 45120814 missense probably damaging 1.00
R7553:Prep UTSW 10 45158524 makesense probably null
R7860:Prep UTSW 10 45091012 missense probably damaging 1.00
Z1176:Prep UTSW 10 45150468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTGAAGTGAGGTCCTGC -3'
(R):5'- TGGTGTGAAAGCCCTTGAGG -3'

Sequencing Primer
(F):5'- TGACGGCCCTCTGTGTAG -3'
(R):5'- TTTGGTGGGAGGAACTGGAAATCC -3'
Posted On2015-04-30