Incidental Mutation 'R4058:Txnrd1'
ID314349
Institutional Source Beutler Lab
Gene Symbol Txnrd1
Ensembl Gene ENSMUSG00000020250
Gene Namethioredoxin reductase 1
SynonymsTR1, TR, TrxR1, TR alpha
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4058 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location82833951-82897712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82885280 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 510 (E510G)
Ref Sequence ENSEMBL: ENSMUSP00000151629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020484] [ENSMUST00000218694] [ENSMUST00000219368] [ENSMUST00000219442] [ENSMUST00000219962]
Predicted Effect probably benign
Transcript: ENSMUST00000020484
AA Change: E396G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000020484
Gene: ENSMUSG00000020250
AA Change: E396G

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 13 350 9.7e-69 PFAM
Pfam:FAD_binding_2 14 69 2.6e-8 PFAM
Pfam:Pyr_redox 192 273 1.3e-18 PFAM
Pfam:Pyr_redox_dim 370 483 8.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218724
Predicted Effect probably benign
Transcript: ENSMUST00000219368
AA Change: E510G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000219442
AA Change: E396G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219911
Predicted Effect probably benign
Transcript: ENSMUST00000219962
AA Change: E396G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.1696 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: This gene encodes a member of the family of pyridine nucleotide-disulfide oxidoreductases. This protein is a flavoenzyme, which uses NADPH for reduction of thioredoxins as well as other protein and nonprotein substrates, and plays a role in protection against oxidative stress. It contains a selenocysteine (Sec) residue, which is essential for catalytic activity. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit early embryonic lethality (by E10.5) and display severe growth retardation and fail to turn. Embryos also exhibit decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Txnrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Txnrd1 APN 10 82875662 missense probably damaging 1.00
IGL00644:Txnrd1 APN 10 82885176 splice site probably benign
IGL01995:Txnrd1 APN 10 82877284 missense probably damaging 1.00
IGL02167:Txnrd1 APN 10 82881911 missense probably benign 0.01
IGL02368:Txnrd1 APN 10 82895974 splice site probably null
IGL02500:Txnrd1 APN 10 82879217 missense probably damaging 1.00
IGL02870:Txnrd1 APN 10 82895979 missense probably benign 0.13
IGL03188:Txnrd1 APN 10 82885046 missense possibly damaging 0.79
IGL03257:Txnrd1 APN 10 82885271 missense probably benign 0.00
F6893:Txnrd1 UTSW 10 82866989 nonsense probably null
R0092:Txnrd1 UTSW 10 82879802 missense probably damaging 1.00
R2019:Txnrd1 UTSW 10 82877373 missense probably benign 0.00
R2088:Txnrd1 UTSW 10 82883910 splice site probably benign
R2101:Txnrd1 UTSW 10 82881739 missense probably damaging 1.00
R2120:Txnrd1 UTSW 10 82887233 missense possibly damaging 0.86
R2696:Txnrd1 UTSW 10 82885282 missense probably benign 0.05
R4059:Txnrd1 UTSW 10 82885280 missense probably benign 0.03
R4879:Txnrd1 UTSW 10 82881917 splice site probably null
R5582:Txnrd1 UTSW 10 82895980 missense possibly damaging 0.72
R6870:Txnrd1 UTSW 10 82873208 missense probably benign 0.45
R6965:Txnrd1 UTSW 10 82881818 missense probably benign 0.02
R7336:Txnrd1 UTSW 10 82873217 missense probably benign 0.00
R7449:Txnrd1 UTSW 10 82885233 nonsense probably null
R8369:Txnrd1 UTSW 10 82874646 missense probably benign 0.01
RF019:Txnrd1 UTSW 10 82885100 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAATGTCAAAGTGAGAATTGCGTTG -3'
(R):5'- GCTGAAGCCATCTTGGTGAG -3'

Sequencing Primer
(F):5'- GTCGCCCGCTGAGACAATG -3'
(R):5'- TCCCGAGGGATCTATCTGATGC -3'
Posted On2015-04-30