Incidental Mutation 'R4058:Tspan8'
ID314350
Institutional Source Beutler Lab
Gene Symbol Tspan8
Ensembl Gene ENSMUSG00000034127
Gene Nametetraspanin 8
SynonymsTm4sf3, E330007O21Rik
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4058 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location115816832-115849893 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 115835282 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 115 (R115*)
Ref Sequence ENSEMBL: ENSMUSP00000136645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035563] [ENSMUST00000080630] [ENSMUST00000179196] [ENSMUST00000217900]
Predicted Effect probably null
Transcript: ENSMUST00000035563
AA Change: R115*
SMART Domains Protein: ENSMUSP00000049243
Gene: ENSMUSG00000034127
AA Change: R115*

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 4.8e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000080630
AA Change: R115*
SMART Domains Protein: ENSMUSP00000079463
Gene: ENSMUSG00000034127
AA Change: R115*

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 8.3e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179196
AA Change: R115*
SMART Domains Protein: ENSMUSP00000136645
Gene: ENSMUSG00000034127
AA Change: R115*

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 8.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220081
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This gene is expressed in different carcinomas. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Tspan8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Tspan8 APN 10 115844139 splice site probably benign
IGL01738:Tspan8 APN 10 115817665 splice site probably null
IGL01755:Tspan8 APN 10 115835298 missense probably damaging 1.00
IGL01993:Tspan8 APN 10 115840008 splice site probably benign
IGL02369:Tspan8 APN 10 115839877 missense probably benign 0.01
IGL02369:Tspan8 APN 10 115839878 missense probably benign 0.44
BB001:Tspan8 UTSW 10 115833324 critical splice donor site probably null
BB011:Tspan8 UTSW 10 115833324 critical splice donor site probably null
PIT4131001:Tspan8 UTSW 10 115817610 missense probably damaging 1.00
R1269:Tspan8 UTSW 10 115849382 missense probably damaging 0.97
R1693:Tspan8 UTSW 10 115844044 splice site probably benign
R1850:Tspan8 UTSW 10 115833225 missense probably damaging 0.98
R1975:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R1976:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R1977:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R4059:Tspan8 UTSW 10 115835282 nonsense probably null
R4999:Tspan8 UTSW 10 115817629 missense possibly damaging 0.91
R5879:Tspan8 UTSW 10 115833251 missense possibly damaging 0.89
R6290:Tspan8 UTSW 10 115827824 missense probably damaging 0.98
R6358:Tspan8 UTSW 10 115833227 missense probably benign 0.12
R6524:Tspan8 UTSW 10 115844079 missense probably benign
R7924:Tspan8 UTSW 10 115833324 critical splice donor site probably null
R8139:Tspan8 UTSW 10 115839897 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGCTGATTCTGATTCTGC -3'
(R):5'- GGGACTAGAAACTGTTCCAAATAC -3'

Sequencing Primer
(F):5'- CTGATTCTGATTCTGCAAGTGGC -3'
(R):5'- TGGCTACAGCTCTAAAGGACCTG -3'
Posted On2015-04-30