Incidental Mutation 'R4058:Mon2'
ID314351
Institutional Source Beutler Lab
Gene Symbol Mon2
Ensembl Gene ENSMUSG00000034602
Gene NameMON2 homolog, regulator of endosome to Golgi trafficking
Synonyms2610528O22Rik, SF21
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock #R4058 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location122992060-123076505 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123002819 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1593 (V1593A)
Ref Sequence ENSEMBL: ENSMUSP00000073462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037557] [ENSMUST00000073792] [ENSMUST00000170935]
Predicted Effect probably benign
Transcript: ENSMUST00000037557
AA Change: V1586A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000037568
Gene: ENSMUSG00000034602
AA Change: V1586A

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 844 929 2.4e-21 PFAM
low complexity region 984 1001 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073792
AA Change: V1593A

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602
AA Change: V1593A

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170935
AA Change: V1587A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131052
Gene: ENSMUSG00000034602
AA Change: V1587A

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 616 628 N/A INTRINSIC
Pfam:DUF1981 845 930 8.1e-22 PFAM
low complexity region 985 1002 N/A INTRINSIC
low complexity region 1183 1194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222536
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Mon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Mon2 APN 10 123026299 missense probably damaging 1.00
IGL01072:Mon2 APN 10 123010539 nonsense probably null
IGL02080:Mon2 APN 10 123052190 missense probably damaging 0.98
IGL02157:Mon2 APN 10 123013472 missense probably damaging 1.00
IGL02419:Mon2 APN 10 123016447 missense probably benign 0.05
IGL02498:Mon2 APN 10 123034330 missense probably benign 0.00
IGL02638:Mon2 APN 10 123023939 missense probably damaging 1.00
IGL02664:Mon2 APN 10 123009496 splice site probably benign
IGL02690:Mon2 APN 10 123009627 missense possibly damaging 0.67
IGL02878:Mon2 APN 10 123006991 missense probably benign 0.09
IGL03092:Mon2 APN 10 123018100 missense probably damaging 1.00
IGL03103:Mon2 APN 10 123030103 splice site probably benign
IGL03208:Mon2 APN 10 123018069 splice site probably benign
R0010:Mon2 UTSW 10 123032694 missense probably damaging 1.00
R0016:Mon2 UTSW 10 123035546 missense probably damaging 0.96
R0016:Mon2 UTSW 10 123035546 missense probably damaging 0.96
R0027:Mon2 UTSW 10 123036048 missense possibly damaging 0.66
R0027:Mon2 UTSW 10 123036048 missense possibly damaging 0.66
R0145:Mon2 UTSW 10 123013512 missense possibly damaging 0.94
R0390:Mon2 UTSW 10 123007021 missense probably null 0.05
R0481:Mon2 UTSW 10 123013396 missense possibly damaging 0.94
R0513:Mon2 UTSW 10 123038610 missense probably damaging 1.00
R0599:Mon2 UTSW 10 123026065 splice site probably benign
R1226:Mon2 UTSW 10 123002819 missense probably benign 0.17
R1548:Mon2 UTSW 10 123036007 splice site probably benign
R1598:Mon2 UTSW 10 123016396 missense probably damaging 1.00
R1650:Mon2 UTSW 10 122995777 missense probably benign 0.45
R1687:Mon2 UTSW 10 123026124 missense probably damaging 0.98
R1721:Mon2 UTSW 10 123031097 missense probably damaging 0.98
R1768:Mon2 UTSW 10 123013763 missense probably benign 0.00
R1827:Mon2 UTSW 10 123046311 missense probably damaging 0.97
R1879:Mon2 UTSW 10 123002885 missense probably damaging 1.00
R1954:Mon2 UTSW 10 123038483 missense probably damaging 1.00
R1955:Mon2 UTSW 10 123038483 missense probably damaging 1.00
R1968:Mon2 UTSW 10 123009565 missense probably damaging 1.00
R2060:Mon2 UTSW 10 122995776 missense probably damaging 1.00
R2160:Mon2 UTSW 10 123075929 nonsense probably null
R2165:Mon2 UTSW 10 123042364 splice site probably null
R3737:Mon2 UTSW 10 123013375 missense probably damaging 1.00
R3814:Mon2 UTSW 10 123013565 missense probably damaging 0.98
R4091:Mon2 UTSW 10 123038510 missense probably damaging 1.00
R4214:Mon2 UTSW 10 123016492 missense probably benign 0.03
R4354:Mon2 UTSW 10 123026983 missense probably benign 0.02
R4422:Mon2 UTSW 10 123042982 missense probably damaging 1.00
R4505:Mon2 UTSW 10 123009589 missense probably damaging 0.99
R4791:Mon2 UTSW 10 123006057 missense probably benign 0.01
R4797:Mon2 UTSW 10 123016517 missense probably benign 0.45
R4944:Mon2 UTSW 10 123038459 critical splice donor site probably null
R4982:Mon2 UTSW 10 122995789 missense probably damaging 1.00
R5298:Mon2 UTSW 10 123010606 missense probably benign
R5503:Mon2 UTSW 10 123032645 missense possibly damaging 0.54
R5653:Mon2 UTSW 10 123026094 missense probably damaging 0.96
R5687:Mon2 UTSW 10 123008239 missense probably damaging 0.99
R5838:Mon2 UTSW 10 123010492 critical splice donor site probably null
R6108:Mon2 UTSW 10 123032695 missense probably benign 0.00
R6182:Mon2 UTSW 10 123038659 splice site probably null
R6355:Mon2 UTSW 10 123022920 missense possibly damaging 0.58
R6358:Mon2 UTSW 10 123013504 missense probably damaging 0.98
R6548:Mon2 UTSW 10 123036093 missense probably damaging 1.00
R6557:Mon2 UTSW 10 123016402 missense probably damaging 1.00
R6649:Mon2 UTSW 10 123038480 missense possibly damaging 0.46
R7140:Mon2 UTSW 10 123035453 missense probably benign 0.00
R7303:Mon2 UTSW 10 123038459 critical splice donor site probably null
R7317:Mon2 UTSW 10 123013946 missense probably damaging 0.97
R7355:Mon2 UTSW 10 123009516 missense probably benign
R7508:Mon2 UTSW 10 123023939 missense probably damaging 1.00
R7509:Mon2 UTSW 10 123032552 missense probably benign
R7647:Mon2 UTSW 10 123006026 missense probably benign
R7720:Mon2 UTSW 10 123032588 missense probably benign 0.00
R7799:Mon2 UTSW 10 123042331 missense probably benign 0.41
R7801:Mon2 UTSW 10 123059186 critical splice donor site probably null
R7823:Mon2 UTSW 10 123032654 missense probably damaging 1.00
R7985:Mon2 UTSW 10 123016308 missense probably damaging 1.00
R8310:Mon2 UTSW 10 123002783 missense probably damaging 1.00
X0022:Mon2 UTSW 10 123006102 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACCAATGACCTCAGTTCCATCTAG -3'
(R):5'- AGGTTGTTCATCAGTGCCTTTC -3'

Sequencing Primer
(F):5'- GAAATCTCTTGGTTTTGAGCAATC -3'
(R):5'- AGTGCCTTTCATCTTATTGATATCC -3'
Posted On2015-04-30