Incidental Mutation 'R4058:Tns3'
ID314352
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Nametensin 3
SynonymsTEM6, F830010I22Rik, Tens1
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location8431652-8664535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8492275 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 696 (D696G)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
Predicted Effect probably damaging
Transcript: ENSMUST00000020695
AA Change: D696G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: D696G

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Meta Mutation Damage Score 0.0942 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8451066 missense probably benign 0.42
IGL00822:Tns3 APN 11 8443976 missense probably damaging 0.99
IGL01075:Tns3 APN 11 8478399 missense probably benign 0.45
IGL01286:Tns3 APN 11 8492617 missense probably benign 0.01
IGL01680:Tns3 APN 11 8548937 missense probably damaging 1.00
IGL01687:Tns3 APN 11 8492798 missense probably damaging 1.00
IGL01734:Tns3 APN 11 8519192 splice site probably benign
IGL01844:Tns3 APN 11 8437177 missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8548992 nonsense probably null
IGL02137:Tns3 APN 11 8492578 missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8434531 missense probably damaging 1.00
IGL02623:Tns3 APN 11 8437141 missense probably damaging 1.00
IGL02697:Tns3 APN 11 8492346 missense probably benign 0.00
IGL02829:Tns3 APN 11 8519564 missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8492149 missense probably benign 0.38
R0020:Tns3 UTSW 11 8545227 critical splice donor site probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0370:Tns3 UTSW 11 8445730 missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8445703 missense probably benign 0.07
R0410:Tns3 UTSW 11 8435852 missense probably benign 0.02
R0496:Tns3 UTSW 11 8547262 splice site probably benign
R0562:Tns3 UTSW 11 8493262 missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8493121 missense probably benign 0.04
R0736:Tns3 UTSW 11 8519474 missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8493302 missense probably damaging 1.00
R1367:Tns3 UTSW 11 8448704 missense probably benign 0.01
R1386:Tns3 UTSW 11 8518261 missense probably benign 0.02
R1975:Tns3 UTSW 11 8435738 missense probably benign 0.04
R2205:Tns3 UTSW 11 8531719 missense probably damaging 1.00
R2319:Tns3 UTSW 11 8541200 missense probably damaging 1.00
R2830:Tns3 UTSW 11 8435870 missense probably damaging 1.00
R3720:Tns3 UTSW 11 8492999 missense probably damaging 1.00
R3765:Tns3 UTSW 11 8451133 missense probably benign 0.00
R3817:Tns3 UTSW 11 8434619 missense probably damaging 1.00
R4599:Tns3 UTSW 11 8531747 missense probably damaging 1.00
R4631:Tns3 UTSW 11 8451119 missense probably benign 0.30
R4731:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4732:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4733:Tns3 UTSW 11 8450986 missense probably benign 0.28
R5472:Tns3 UTSW 11 8451092 missense probably benign
R5749:Tns3 UTSW 11 8451177 missense probably benign 0.01
R5807:Tns3 UTSW 11 8493211 missense probably damaging 1.00
R5844:Tns3 UTSW 11 8434580 missense probably damaging 1.00
R5942:Tns3 UTSW 11 8435860 missense probably damaging 1.00
R5982:Tns3 UTSW 11 8492245 missense probably damaging 0.99
R6025:Tns3 UTSW 11 8492578 missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8492987 missense probably damaging 1.00
R6322:Tns3 UTSW 11 8492147 missense probably benign 0.01
R6536:Tns3 UTSW 11 8434531 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549057 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549058 missense probably damaging 1.00
R6864:Tns3 UTSW 11 8493196 missense probably damaging 1.00
R6897:Tns3 UTSW 11 8531743 missense probably damaging 1.00
R7108:Tns3 UTSW 11 8437251 missense probably benign 0.00
R7443:Tns3 UTSW 11 8451442 missense probably benign 0.01
R7459:Tns3 UTSW 11 8492793 missense probably benign 0.16
R7474:Tns3 UTSW 11 8530894 missense probably damaging 1.00
R7576:Tns3 UTSW 11 8541192 missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8492701 missense probably benign 0.01
R8055:Tns3 UTSW 11 8545343 missense probably damaging 1.00
R8057:Tns3 UTSW 11 8492773 missense probably benign
R8077:Tns3 UTSW 11 8445667 missense probably damaging 1.00
R8518:Tns3 UTSW 11 8492971 missense probably damaging 0.96
R8523:Tns3 UTSW 11 8448779 missense probably damaging 1.00
T0975:Tns3 UTSW 11 8451146 missense probably benign 0.00
T0975:Tns3 UTSW 11 8479518 missense probably benign
T0975:Tns3 UTSW 11 8549100 start gained probably benign
X0005:Tns3 UTSW 11 8451224 missense probably benign 0.00
X0005:Tns3 UTSW 11 8479518 missense probably benign
Z1177:Tns3 UTSW 11 8451014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCATAGATACTTCCTACCTG -3'
(R):5'- AGCAGAGTGGCTGTTCAGAG -3'

Sequencing Primer
(F):5'- ATCAGCTCACCTTGCCGG -3'
(R):5'- CTGTTCAGAGAGGCATCAGC -3'
Posted On2015-04-30