Mutagenetix > Incidental Mutations

Incidental Mutation 'R4058:Tns3'

314352

Institutional Source

Beutler Lab

Gene Symbol

Tns3

Ensembl Gene

ENSMUSG00000020422

Gene Name

tensin 3

Synonyms

TEM6, F830010I22Rik, Tens1

MMRRC Submission

040969-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.394) question?

Stock #

R4058 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8431652-8664535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8492275 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 696 (D696G)

Ref Sequence

ENSEMBL: ENSMUSP00000020695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020695]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020695
AA Change: D696G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: D696G

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	1	171	5e-28	SMART
PTEN_C2	173	300	1.15e-48	SMART
low complexity region	854	864	N/A	INTRINSIC
low complexity region	1102	1126	N/A	INTRINSIC
SH2	1165	1268	1.32e-18	SMART
PTB	1301	1438	3.14e-24	SMART

Meta Mutation Damage Score

0.0942

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

88% (38/43)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930453N24Rik	A	G	16: 64,766,458	V301A	probably benign	Het
Adam15	A	G	3: 89,347,055	V145A	possibly damaging	Het
Anxa4	C	T	6: 86,757,818		probably null	Het
Aqp9	C	A	9: 71,130,444	V184L	probably benign	Het
Atp13a3	C	A	16: 30,354,246	C271F	possibly damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
C130060K24Rik	T	A	6: 65,381,541	I83N	probably damaging	Het
Cldn34c4	C	A	X: 127,721,437	V137F	probably benign	Het
Cngb1	T	C	8: 95,267,654	E163G	probably benign	Het
Dync1i1	A	G	6: 5,769,764	D113G	probably damaging	Het
Etl4	T	A	2: 20,806,019	V971D	possibly damaging	Het
Gys1	A	G	7: 45,448,386		probably benign	Het
H13	C	G	2: 152,691,874	P227R	probably damaging	Het
Ift22	C	A	5: 136,911,863	P84Q	unknown	Het
Igfn1	A	G	1: 135,969,756	V1024A	probably benign	Het
Kdm8	T	A	7: 125,456,494	Y65N	probably damaging	Het
Lbp	T	A	2: 158,324,630	V368E	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Megf6	T	C	4: 154,242,532		probably benign	Het
Mettl13	G	T	1: 162,546,186	H165Q	probably damaging	Het
Mitd1	C	T	1: 37,881,026	S167N	probably benign	Het
Mon2	A	G	10: 123,002,819	V1593A	probably benign	Het
Nkx3-2	T	A	5: 41,762,063	E194V	possibly damaging	Het
Nup210	A	T	6: 91,060,620	V757D	probably benign	Het
Olfr1031	T	A	2: 85,992,232	S138R	possibly damaging	Het
Olfr1328	T	C	4: 118,934,683	D53G	probably damaging	Het
Opcml	A	G	9: 28,901,588	Y192C	probably damaging	Het
Pcdha2	A	G	18: 36,939,882	S189G	probably benign	Het
Pkd2l2	T	C	18: 34,428,192	F418L	probably benign	Het
Plekhg1	A	G	10: 3,957,087	D668G	probably damaging	Het
Prep	G	A	10: 45,158,371	V660M	probably benign	Het
Rgs8	A	G	1: 153,690,996	T98A	probably null	Het
Rhbdd1	A	G	1: 82,370,381	N235D	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Sgo2b	A	T	8: 63,926,947	D950E	probably damaging	Het
Slc1a5	T	C	7: 16,795,853	V399A	probably damaging	Het
Spag16	A	T	1: 69,853,328	Q89H	probably damaging	Het
Spta1	T	C	1: 174,241,137	W2168R	probably damaging	Het
Taok1	T	A	11: 77,549,438	K581M	probably benign	Het
Tspan8	C	T	10: 115,835,282	R115*	probably null	Het
Txnrd1	A	G	10: 82,885,280	E510G	probably benign	Het
Usp45	T	C	4: 21,810,746	I314T	probably damaging	Het
Vmn2r15	T	A	5: 109,293,446	H182L	probably damaging	Het
Vmn2r76	A	C	7: 86,230,300	M264R	probably benign	Het

Other mutations in Tns3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tns3	APN	11	8451066	missense	probably benign	0.42
IGL00822:Tns3	APN	11	8443976	missense	probably damaging	0.99
IGL01075:Tns3	APN	11	8478399	missense	probably benign	0.45
IGL01286:Tns3	APN	11	8492617	missense	probably benign	0.01
IGL01680:Tns3	APN	11	8548937	missense	probably damaging	1.00
IGL01687:Tns3	APN	11	8492798	missense	probably damaging	1.00
IGL01734:Tns3	APN	11	8519192	splice site	probably benign
IGL01844:Tns3	APN	11	8437177	missense	possibly damaging	0.58
IGL01984:Tns3	APN	11	8548992	nonsense	probably null
IGL02137:Tns3	APN	11	8492578	missense	possibly damaging	0.93
IGL02273:Tns3	APN	11	8434531	missense	probably damaging	1.00
IGL02623:Tns3	APN	11	8437141	missense	probably damaging	1.00
IGL02697:Tns3	APN	11	8492346	missense	probably benign	0.00
IGL02829:Tns3	APN	11	8519564	missense	probably damaging	1.00
ANU74:Tns3	UTSW	11	8492149	missense	probably benign	0.38
R0020:Tns3	UTSW	11	8545227	critical splice donor site	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0370:Tns3	UTSW	11	8445730	missense	possibly damaging	0.80
R0388:Tns3	UTSW	11	8445703	missense	probably benign	0.07
R0410:Tns3	UTSW	11	8435852	missense	probably benign	0.02
R0496:Tns3	UTSW	11	8547262	splice site	probably benign
R0562:Tns3	UTSW	11	8493262	missense	possibly damaging	0.93
R0626:Tns3	UTSW	11	8493121	missense	probably benign	0.04
R0736:Tns3	UTSW	11	8519474	missense	possibly damaging	0.94
R0893:Tns3	UTSW	11	8493302	missense	probably damaging	1.00
R1367:Tns3	UTSW	11	8448704	missense	probably benign	0.01
R1386:Tns3	UTSW	11	8518261	missense	probably benign	0.02
R1975:Tns3	UTSW	11	8435738	missense	probably benign	0.04
R2205:Tns3	UTSW	11	8531719	missense	probably damaging	1.00
R2319:Tns3	UTSW	11	8541200	missense	probably damaging	1.00
R2830:Tns3	UTSW	11	8435870	missense	probably damaging	1.00
R3720:Tns3	UTSW	11	8492999	missense	probably damaging	1.00
R3765:Tns3	UTSW	11	8451133	missense	probably benign	0.00
R3817:Tns3	UTSW	11	8434619	missense	probably damaging	1.00
R4599:Tns3	UTSW	11	8531747	missense	probably damaging	1.00
R4631:Tns3	UTSW	11	8451119	missense	probably benign	0.30
R4731:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4732:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4733:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R5472:Tns3	UTSW	11	8451092	missense	probably benign
R5749:Tns3	UTSW	11	8451177	missense	probably benign	0.01
R5807:Tns3	UTSW	11	8493211	missense	probably damaging	1.00
R5844:Tns3	UTSW	11	8434580	missense	probably damaging	1.00
R5942:Tns3	UTSW	11	8435860	missense	probably damaging	1.00
R5982:Tns3	UTSW	11	8492245	missense	probably damaging	0.99
R6025:Tns3	UTSW	11	8492578	missense	possibly damaging	0.93
R6266:Tns3	UTSW	11	8492987	missense	probably damaging	1.00
R6322:Tns3	UTSW	11	8492147	missense	probably benign	0.01
R6536:Tns3	UTSW	11	8434531	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549057	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549058	missense	probably damaging	1.00
R6864:Tns3	UTSW	11	8493196	missense	probably damaging	1.00
R6897:Tns3	UTSW	11	8531743	missense	probably damaging	1.00
R7108:Tns3	UTSW	11	8437251	missense	probably benign	0.00
R7443:Tns3	UTSW	11	8451442	missense	probably benign	0.01
R7459:Tns3	UTSW	11	8492793	missense	probably benign	0.16
R7474:Tns3	UTSW	11	8530894	missense	probably damaging	1.00
R7576:Tns3	UTSW	11	8541192	missense	possibly damaging	0.78
R7979:Tns3	UTSW	11	8492701	missense	probably benign	0.01
R8055:Tns3	UTSW	11	8545343	missense	probably damaging	1.00
R8057:Tns3	UTSW	11	8492773	missense	probably benign
R8077:Tns3	UTSW	11	8445667	missense	probably damaging	1.00
R8518:Tns3	UTSW	11	8492971	missense	probably damaging	0.96
R8523:Tns3	UTSW	11	8448779	missense	probably damaging	1.00
T0975:Tns3	UTSW	11	8451146	missense	probably benign	0.00
T0975:Tns3	UTSW	11	8479518	missense	probably benign
T0975:Tns3	UTSW	11	8549100	start gained	probably benign
X0005:Tns3	UTSW	11	8451224	missense	probably benign	0.00
X0005:Tns3	UTSW	11	8479518	missense	probably benign
Z1177:Tns3	UTSW	11	8451014	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTGCATAGATACTTCCTACCTG -3'
(R):5'- AGCAGAGTGGCTGTTCAGAG -3'

Sequencing Primer
(F):5'- ATCAGCTCACCTTGCCGG -3'
(R):5'- CTGTTCAGAGAGGCATCAGC -3'

Posted On

2015-04-30