Incidental Mutation 'R4058:Atp13a3'
ID314355
Institutional Source Beutler Lab
Gene Symbol Atp13a3
Ensembl Gene ENSMUSG00000022533
Gene NameATPase type 13A3
SynonymsLOC224088, LOC385637, LOC224087
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location30312423-30405975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30354246 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 271 (C271F)
Ref Sequence ENSEMBL: ENSMUSP00000128224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061350] [ENSMUST00000100013]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061350
AA Change: C271F

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051645
Gene: ENSMUSG00000022533
AA Change: C271F

DomainStartEndE-ValueType
Pfam:P5-ATPase 13 139 4.9e-30 PFAM
Cation_ATPase_N 154 227 7.24e0 SMART
Pfam:E1-E2_ATPase 232 483 5.1e-36 PFAM
Pfam:HAD 491 888 7.5e-28 PFAM
Pfam:Hydrolase_like2 607 661 6.8e-8 PFAM
Pfam:Hydrolase 612 790 6.5e-11 PFAM
transmembrane domain 931 953 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
transmembrane domain 997 1019 N/A INTRINSIC
transmembrane domain 1068 1085 N/A INTRINSIC
transmembrane domain 1098 1120 N/A INTRINSIC
transmembrane domain 1135 1153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100013
AA Change: C271F

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128224
Gene: ENSMUSG00000022533
AA Change: C271F

DomainStartEndE-ValueType
Pfam:P5-ATPase 13 146 2.9e-38 PFAM
Cation_ATPase_N 154 227 7.24e0 SMART
Pfam:E1-E2_ATPase 232 483 7.3e-41 PFAM
Pfam:Hydrolase 488 784 1.3e-12 PFAM
Pfam:HAD 491 888 1.3e-31 PFAM
Pfam:Cation_ATPase 612 660 4.5e-7 PFAM
transmembrane domain 931 953 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
transmembrane domain 997 1019 N/A INTRINSIC
transmembrane domain 1068 1085 N/A INTRINSIC
transmembrane domain 1098 1120 N/A INTRINSIC
transmembrane domain 1135 1157 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149882
Meta Mutation Damage Score 0.2498 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATP13A3 is a member of the P-type ATPase family of proteins that transport a variety of cations across membranes. Other P-type ATPases include ATP7B (MIM 606882) and ATP7A (MIM 300011).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Atp13a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Atp13a3 APN 16 30351279 missense probably damaging 0.99
IGL00490:Atp13a3 APN 16 30352354 missense probably benign 0.31
IGL01844:Atp13a3 APN 16 30361963 missense probably benign 0.17
IGL01994:Atp13a3 APN 16 30337518 missense possibly damaging 0.90
IGL02057:Atp13a3 APN 16 30332364 missense probably benign
IGL02083:Atp13a3 APN 16 30347706 missense possibly damaging 0.89
IGL02348:Atp13a3 APN 16 30351228 critical splice donor site probably null
IGL02352:Atp13a3 APN 16 30351084 missense probably damaging 1.00
IGL02359:Atp13a3 APN 16 30351084 missense probably damaging 1.00
IGL02643:Atp13a3 APN 16 30333796 missense probably null
IGL02687:Atp13a3 APN 16 30337551 missense probably damaging 1.00
IGL02951:Atp13a3 APN 16 30338621 splice site probably null
IGL03190:Atp13a3 APN 16 30322948 missense probably benign 0.00
H8562:Atp13a3 UTSW 16 30359725 nonsense probably null
H8786:Atp13a3 UTSW 16 30359725 nonsense probably null
PIT4812001:Atp13a3 UTSW 16 30362578 missense probably damaging 0.98
R0725:Atp13a3 UTSW 16 30351387 missense probably damaging 1.00
R1208:Atp13a3 UTSW 16 30354247 missense probably benign 0.21
R1208:Atp13a3 UTSW 16 30354247 missense probably benign 0.21
R1244:Atp13a3 UTSW 16 30361836 missense probably benign 0.00
R1326:Atp13a3 UTSW 16 30352310 missense probably damaging 1.00
R1613:Atp13a3 UTSW 16 30332300 missense probably damaging 1.00
R1672:Atp13a3 UTSW 16 30332274 missense possibly damaging 0.96
R1709:Atp13a3 UTSW 16 30315841 missense probably benign 0.37
R1733:Atp13a3 UTSW 16 30357266 missense probably benign 0.35
R2086:Atp13a3 UTSW 16 30352298 missense possibly damaging 0.89
R2128:Atp13a3 UTSW 16 30354276 missense probably damaging 0.97
R2421:Atp13a3 UTSW 16 30349825 missense probably benign 0.29
R3427:Atp13a3 UTSW 16 30344593 missense probably benign 0.05
R3783:Atp13a3 UTSW 16 30354249 missense probably damaging 1.00
R4059:Atp13a3 UTSW 16 30354246 missense possibly damaging 0.94
R4798:Atp13a3 UTSW 16 30341240 missense probably damaging 1.00
R5045:Atp13a3 UTSW 16 30339876 missense probably benign 0.24
R5216:Atp13a3 UTSW 16 30340284 missense probably damaging 1.00
R5704:Atp13a3 UTSW 16 30321879 missense probably benign 0.18
R5876:Atp13a3 UTSW 16 30362734 missense probably benign 0.13
R5947:Atp13a3 UTSW 16 30362700 missense probably benign 0.01
R6291:Atp13a3 UTSW 16 30336243 missense probably damaging 0.99
R6324:Atp13a3 UTSW 16 30332285 missense possibly damaging 0.72
R6328:Atp13a3 UTSW 16 30336235 missense probably damaging 0.99
R6372:Atp13a3 UTSW 16 30343455 missense probably damaging 0.99
R6446:Atp13a3 UTSW 16 30361869 missense probably benign 0.00
R7016:Atp13a3 UTSW 16 30338490 missense possibly damaging 0.54
R7086:Atp13a3 UTSW 16 30351063 missense possibly damaging 0.87
R7241:Atp13a3 UTSW 16 30352277 missense possibly damaging 0.93
R7589:Atp13a3 UTSW 16 30344615 missense probably benign 0.04
R8098:Atp13a3 UTSW 16 30354297 missense possibly damaging 0.85
R8191:Atp13a3 UTSW 16 30349780 missense probably damaging 1.00
R8299:Atp13a3 UTSW 16 30333801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTCTTGATCCAGGTCATGC -3'
(R):5'- GACTTTTCACCTTTTACATAGGCAG -3'

Sequencing Primer
(F):5'- CTGATAAACCAGGACCCATGTGG -3'
(R):5'- TTCCCCCAGCAATATGTTA -3'
Posted On2015-04-30