Incidental Mutation 'R4058:4930453N24Rik'
ID314356
Institutional Source Beutler Lab
Gene Symbol 4930453N24Rik
Ensembl Gene ENSMUSG00000059920
Gene NameRIKEN cDNA 4930453N24 gene
Synonyms
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location64751751-64771161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64766458 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 301 (V301A)
Ref Sequence ENSEMBL: ENSMUSP00000076255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076991]
Predicted Effect probably benign
Transcript: ENSMUST00000076991
AA Change: V301A

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076255
Gene: ENSMUSG00000059920
AA Change: V301A

DomainStartEndE-ValueType
Pfam:DUF4518 4 274 1.8e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162732
Meta Mutation Damage Score 0.2314 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype PHENOTYPE: Homozygous mutants show arrested eruption of incisors causing dentin formation to continue and occlude the pulp chamber. Mice also display small size, reduced ear pinna, and have abnormal coat color and patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in 4930453N24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03358:4930453N24Rik APN 16 64766546 missense possibly damaging 0.80
R0614:4930453N24Rik UTSW 16 64766614 missense probably damaging 1.00
R1729:4930453N24Rik UTSW 16 64769022 missense probably damaging 0.96
R1784:4930453N24Rik UTSW 16 64769022 missense probably damaging 0.96
R4059:4930453N24Rik UTSW 16 64766458 missense probably benign 0.43
R7099:4930453N24Rik UTSW 16 64770788 missense probably benign 0.36
R8298:4930453N24Rik UTSW 16 64766332 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGCAGTGGCTTAGAGATAG -3'
(R):5'- CACCGAGGAAATTCTTGTTTGG -3'

Sequencing Primer
(F):5'- CAGTGGCTTAGAGATAGATGGTC -3'
(R):5'- GGGCATATTTGAGCAAATTTTTGGAC -3'
Posted On2015-04-30