Incidental Mutation 'R4058:Cldn34c4'
ID314358
Institutional Source Beutler Lab
Gene Symbol Cldn34c4
Ensembl Gene ENSMUSG00000043569
Gene Nameclaudin 34C4
Synonyms4930412D23Rik
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4058 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location127721182-127736554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127721437 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 137 (V137F)
Ref Sequence ENSEMBL: ENSMUSP00000062601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052500]
Predicted Effect probably benign
Transcript: ENSMUST00000052500
AA Change: V137F

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000062601
Gene: ENSMUSG00000043569
AA Change: V137F

DomainStartEndE-ValueType
Pfam:Claudin_2 19 199 1.8e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Cldn34c4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4085:Cldn34c4 UTSW X 127721388 missense probably damaging 1.00
R4086:Cldn34c4 UTSW X 127721388 missense probably damaging 1.00
R4087:Cldn34c4 UTSW X 127721388 missense probably damaging 1.00
R4090:Cldn34c4 UTSW X 127721388 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTGAGTCCCCAAAGCC -3'
(R):5'- GCACTACTCCTACCATGATGCC -3'

Sequencing Primer
(F):5'- CCCTTTTTCCATTGAAGGACTGTAAG -3'
(R):5'- ATGATGCCCTCGTTCCTTTGG -3'
Posted On2015-04-30