Incidental Mutation 'R0388:Tmem173'
ID31436
Institutional Source Beutler Lab
Gene Symbol Tmem173
Ensembl Gene ENSMUSG00000024349
Gene Nametransmembrane protein 173
Synonyms2610307O08Rik, MPYS, Sting, ERIS
MMRRC Submission 038594-MU
Accession Numbers

Ncbi RefSeq:NM_028261.1; MGI: 1919762

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0388 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location35733678-35740554 bp(-) (GRCm38)
Type of Mutationunclassified (4242 bp from exon)
DNA Base Change (assembly) A to G at 35735111 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097617] [ENSMUST00000115728]
Predicted Effect probably null
Transcript: ENSMUST00000097617
SMART Domains Protein: ENSMUSP00000095222
Gene: ENSMUSG00000073598

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115728
AA Change: V312A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111393
Gene: ENSMUSG00000024349
AA Change: V312A

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:TMEM173 44 336 4.7e-125 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype Strain: 3817418; 4939597
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to viral infection and abnormal innate immunity. Mice homozygous for an ENU-induced allele exhibit altered response to bacterial and viral infection. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Tmem173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Tmem173 APN 18 35734567 missense probably damaging 0.99
R0226:Tmem173 UTSW 18 35739088 missense probably benign
R0924:Tmem173 UTSW 18 35735101 critical splice donor site probably null
R2102:Tmem173 UTSW 18 35735237 missense probably damaging 1.00
R4159:Tmem173 UTSW 18 35739219 missense probably damaging 1.00
R4604:Tmem173 UTSW 18 35738690 missense probably damaging 0.97
R6209:Tmem173 UTSW 18 35736102 missense probably damaging 1.00
R6866:Tmem173 UTSW 18 35739429 missense probably damaging 0.97
R7008:Tmem173 UTSW 18 35735171 missense probably damaging 1.00
R7083:Tmem173 UTSW 18 35734650 missense probably damaging 1.00
R7492:Tmem173 UTSW 18 35738713 missense probably damaging 1.00
R7726:Tmem173 UTSW 18 35735265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGAGGTCACACAACCAAG -3'
(R):5'- TGTGAAGTGTTTAGCCCAGCCC -3'

Sequencing Primer
(F):5'- cacaaccaaggcacattagag -3'
(R):5'- CCTAGCAGGGCAGTTACATC -3'
Posted On2013-04-24