Incidental Mutation 'R0388:Pank1'
ID31437
Institutional Source Beutler Lab
Gene Symbol Pank1
Ensembl Gene ENSMUSG00000033610
Gene Namepantothenate kinase 1
SynonymsPank1a, Pank1, 4632412I06Rik, Pank1b, 5430426F23Rik
MMRRC Submission 038594-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0388 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34810894-34879455 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 34821706 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036584] [ENSMUST00000112460]
Predicted Effect probably benign
Transcript: ENSMUST00000036584
SMART Domains Protein: ENSMUSP00000043562
Gene: ENSMUSG00000033610

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 135 147 N/A INTRINSIC
Pfam:Fumble 188 540 1.6e-121 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083660
Predicted Effect probably benign
Transcript: ENSMUST00000112460
SMART Domains Protein: ENSMUSP00000108079
Gene: ENSMUSG00000033610

DomainStartEndE-ValueType
Pfam:Fumble 13 365 3.8e-122 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pantothenate kinase family. Pantothenate kinases are key regulatory enzymes in the biosynthesis of coenzyme A (CoA). The encoded protein catalyzes the first and rate-limiting enzymatic reaction in CoA biosynthesis and is regulated by CoA through feedback inhibition. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene and an intronic miRNA on the same strand are co-regulated by the tumor suppressor p53 (see PMID 20833636). [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutant has increased body weight, polyphagia, decreased serum triglyceride and glucose levels after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Pank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Pank1 APN 19 34840852 missense probably damaging 1.00
IGL02266:Pank1 APN 19 34813686 splice site probably benign
IGL02814:Pank1 APN 19 34840855 missense probably damaging 1.00
IGL03029:Pank1 APN 19 34821135 missense probably damaging 0.96
PIT4402001:Pank1 UTSW 19 34840966 missense probably damaging 1.00
R1254:Pank1 UTSW 19 34840860 missense probably benign 0.16
R1820:Pank1 UTSW 19 34877684 critical splice donor site probably null
R1928:Pank1 UTSW 19 34878881 missense probably benign
R2117:Pank1 UTSW 19 34841086 missense probably damaging 1.00
R2141:Pank1 UTSW 19 34878980 missense possibly damaging 0.91
R2147:Pank1 UTSW 19 34827354 missense probably benign 0.12
R2226:Pank1 UTSW 19 34827363 missense probably damaging 1.00
R4363:Pank1 UTSW 19 34827132 missense probably damaging 1.00
R4376:Pank1 UTSW 19 34877704 missense probably benign
R5081:Pank1 UTSW 19 34878916 missense probably benign
R5172:Pank1 UTSW 19 34840802 nonsense probably null
R6706:Pank1 UTSW 19 34812386 missense probably damaging 1.00
R6811:Pank1 UTSW 19 34841022 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GTTTCAGCGCCTCACTAAGGACAG -3'
(R):5'- TTGGATGGGCATATCACAAAGCGAC -3'

Sequencing Primer
(F):5'- CAGGAATCAAGTCTGAGGTCTGAC -3'
(R):5'- CAGTCTTGGAGGTGGGACATTC -3'
Posted On2013-04-24